ID: 928797066

View in Genome Browser
Species Human (GRCh38)
Location 2:35034933-35034955
Sequence GGTGCTGTTATGACCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928797066_928797073 22 Left 928797066 2:35034933-35034955 CCTGGCTGGGTCATAACAGCACC No data
Right 928797073 2:35034978-35035000 CTGAAATTGGAGTGGGCACCAGG No data
928797066_928797072 15 Left 928797066 2:35034933-35034955 CCTGGCTGGGTCATAACAGCACC No data
Right 928797072 2:35034971-35034993 CTTTGCTCTGAAATTGGAGTGGG No data
928797066_928797071 14 Left 928797066 2:35034933-35034955 CCTGGCTGGGTCATAACAGCACC No data
Right 928797071 2:35034970-35034992 ACTTTGCTCTGAAATTGGAGTGG No data
928797066_928797070 9 Left 928797066 2:35034933-35034955 CCTGGCTGGGTCATAACAGCACC No data
Right 928797070 2:35034965-35034987 CTTCAACTTTGCTCTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928797066 Original CRISPR GGTGCTGTTATGACCCAGCC AGG (reversed) Intergenic