ID: 928803261

View in Genome Browser
Species Human (GRCh38)
Location 2:35119938-35119960
Sequence TGCTGAATATCAATGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928803261_928803264 28 Left 928803261 2:35119938-35119960 CCTTTCACCATTGATATTCAGCA No data
Right 928803264 2:35119989-35120011 CGAAAAAGATTTTTTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928803261 Original CRISPR TGCTGAATATCAATGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr