ID: 928805180

View in Genome Browser
Species Human (GRCh38)
Location 2:35141254-35141276
Sequence AGTTTTTTACAGATGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928805180_928805182 19 Left 928805180 2:35141254-35141276 CCTTCCATCATCTGTAAAAAACT No data
Right 928805182 2:35141296-35141318 TAAACAACCCCATTAAAAAGTGG 0: 62
1: 1352
2: 15599
3: 10820
4: 7834
928805180_928805183 20 Left 928805180 2:35141254-35141276 CCTTCCATCATCTGTAAAAAACT No data
Right 928805183 2:35141297-35141319 AAACAACCCCATTAAAAAGTGGG 0: 1104
1: 15196
2: 10470
3: 6994
4: 5803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928805180 Original CRISPR AGTTTTTTACAGATGATGGA AGG (reversed) Intergenic
No off target data available for this crispr