ID: 928805182

View in Genome Browser
Species Human (GRCh38)
Location 2:35141296-35141318
Sequence TAAACAACCCCATTAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35667
Summary {0: 62, 1: 1352, 2: 15599, 3: 10820, 4: 7834}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928805180_928805182 19 Left 928805180 2:35141254-35141276 CCTTCCATCATCTGTAAAAAACT No data
Right 928805182 2:35141296-35141318 TAAACAACCCCATTAAAAAGTGG 0: 62
1: 1352
2: 15599
3: 10820
4: 7834
928805181_928805182 15 Left 928805181 2:35141258-35141280 CCATCATCTGTAAAAAACTTAAG No data
Right 928805182 2:35141296-35141318 TAAACAACCCCATTAAAAAGTGG 0: 62
1: 1352
2: 15599
3: 10820
4: 7834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928805182 Original CRISPR TAAACAACCCCATTAAAAAG TGG Intergenic
Too many off-targets to display for this crispr