ID: 928805183

View in Genome Browser
Species Human (GRCh38)
Location 2:35141297-35141319
Sequence AAACAACCCCATTAAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39567
Summary {0: 1104, 1: 15196, 2: 10470, 3: 6994, 4: 5803}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928805181_928805183 16 Left 928805181 2:35141258-35141280 CCATCATCTGTAAAAAACTTAAG No data
Right 928805183 2:35141297-35141319 AAACAACCCCATTAAAAAGTGGG 0: 1104
1: 15196
2: 10470
3: 6994
4: 5803
928805180_928805183 20 Left 928805180 2:35141254-35141276 CCTTCCATCATCTGTAAAAAACT No data
Right 928805183 2:35141297-35141319 AAACAACCCCATTAAAAAGTGGG 0: 1104
1: 15196
2: 10470
3: 6994
4: 5803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928805183 Original CRISPR AAACAACCCCATTAAAAAGT GGG Intergenic
Too many off-targets to display for this crispr