ID: 928816374

View in Genome Browser
Species Human (GRCh38)
Location 2:35299595-35299617
Sequence GAAAATGCTCACAAGCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928816371_928816374 1 Left 928816371 2:35299571-35299593 CCAGACAATGAAACACCAGTGCA No data
Right 928816374 2:35299595-35299617 GAAAATGCTCACAAGCATCTTGG No data
928816368_928816374 30 Left 928816368 2:35299542-35299564 CCTCAAAGAACTTTTAACTGTGA No data
Right 928816374 2:35299595-35299617 GAAAATGCTCACAAGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928816374 Original CRISPR GAAAATGCTCACAAGCATCT TGG Intergenic
No off target data available for this crispr