ID: 928816374 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:35299595-35299617 |
| Sequence | GAAAATGCTCACAAGCATCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 928816371_928816374 | 1 | Left | 928816371 | 2:35299571-35299593 | CCAGACAATGAAACACCAGTGCA | No data | ||
| Right | 928816374 | 2:35299595-35299617 | GAAAATGCTCACAAGCATCTTGG | No data | ||||
| 928816368_928816374 | 30 | Left | 928816368 | 2:35299542-35299564 | CCTCAAAGAACTTTTAACTGTGA | No data | ||
| Right | 928816374 | 2:35299595-35299617 | GAAAATGCTCACAAGCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 928816374 | Original CRISPR | GAAAATGCTCACAAGCATCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||