ID: 928816881

View in Genome Browser
Species Human (GRCh38)
Location 2:35307565-35307587
Sequence CATGCGTAGAAGGAATGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928816881_928816884 6 Left 928816881 2:35307565-35307587 CCAGGCCATTCCTTCTACGCATG No data
Right 928816884 2:35307594-35307616 TTGTGTCATCTTTCGTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928816881 Original CRISPR CATGCGTAGAAGGAATGGCC TGG (reversed) Intergenic
No off target data available for this crispr