ID: 928819320

View in Genome Browser
Species Human (GRCh38)
Location 2:35342079-35342101
Sequence TCAGCTGGTTGAAGGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928819320_928819328 2 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819328 2:35342104-35342126 GACAGGGAGTTTGGCTGGGACGG No data
928819320_928819332 30 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819332 2:35342132-35342154 GGAGAGCCCGGGCTGCTAAGTGG No data
928819320_928819331 19 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819331 2:35342121-35342143 GGACGGTCAGAGGAGAGCCCGGG No data
928819320_928819330 18 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819330 2:35342120-35342142 GGGACGGTCAGAGGAGAGCCCGG No data
928819320_928819329 9 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819329 2:35342111-35342133 AGTTTGGCTGGGACGGTCAGAGG No data
928819320_928819326 -3 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819326 2:35342099-35342121 TGAATGACAGGGAGTTTGGCTGG No data
928819320_928819325 -7 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819325 2:35342095-35342117 CAGCTGAATGACAGGGAGTTTGG No data
928819320_928819327 -2 Left 928819320 2:35342079-35342101 CCAGCAGGCCTTCAACCAGCTGA No data
Right 928819327 2:35342100-35342122 GAATGACAGGGAGTTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928819320 Original CRISPR TCAGCTGGTTGAAGGCCTGC TGG (reversed) Intergenic