ID: 928826062

View in Genome Browser
Species Human (GRCh38)
Location 2:35422532-35422554
Sequence GTTTCTACAAAGTTTACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928826062_928826068 22 Left 928826062 2:35422532-35422554 CCCTATGTAAACTTTGTAGAAAC No data
Right 928826068 2:35422577-35422599 CTTATTTAAGGTAATTCAGTGGG No data
928826062_928826066 10 Left 928826062 2:35422532-35422554 CCCTATGTAAACTTTGTAGAAAC No data
Right 928826066 2:35422565-35422587 AGATACAATTGACTTATTTAAGG No data
928826062_928826067 21 Left 928826062 2:35422532-35422554 CCCTATGTAAACTTTGTAGAAAC No data
Right 928826067 2:35422576-35422598 ACTTATTTAAGGTAATTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928826062 Original CRISPR GTTTCTACAAAGTTTACATA GGG (reversed) Intergenic
No off target data available for this crispr