ID: 928828103

View in Genome Browser
Species Human (GRCh38)
Location 2:35444547-35444569
Sequence ATACAAGTCTACCAAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928828103_928828106 -2 Left 928828103 2:35444547-35444569 CCTTTCCCTTGGTAGACTTGTAT No data
Right 928828106 2:35444568-35444590 ATTAACTAACCCCAAGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928828103 Original CRISPR ATACAAGTCTACCAAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr