ID: 928830364

View in Genome Browser
Species Human (GRCh38)
Location 2:35475439-35475461
Sequence GAGGGTAAAATGAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928830360_928830364 14 Left 928830360 2:35475402-35475424 CCAAAGAGTAGCTACACACCAAA No data
Right 928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG No data
928830359_928830364 23 Left 928830359 2:35475393-35475415 CCTCAAGAACCAAAGAGTAGCTA No data
Right 928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG No data
928830361_928830364 -4 Left 928830361 2:35475420-35475442 CCAAAGAATAGAAAGCATTGAGG No data
Right 928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928830364 Original CRISPR GAGGGTAAAATGAGAGAAGC AGG Intergenic
No off target data available for this crispr