ID: 928833902

View in Genome Browser
Species Human (GRCh38)
Location 2:35521019-35521041
Sequence AGGAACTCCTTGGGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928833902_928833909 25 Left 928833902 2:35521019-35521041 CCTGCTTTTCCCAAGGAGTTCCT No data
Right 928833909 2:35521067-35521089 TCTCATGTGTGCATTAAGAGTGG 0: 23
1: 45
2: 87
3: 63
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928833902 Original CRISPR AGGAACTCCTTGGGAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr