ID: 928839412

View in Genome Browser
Species Human (GRCh38)
Location 2:35587235-35587257
Sequence TTTATTTTTACTGGGAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928839412_928839419 28 Left 928839412 2:35587235-35587257 CCAAGACTCCCAGTAAAAATAAA No data
Right 928839419 2:35587286-35587308 AAGGTTAGCACTAGTATTGATGG No data
928839412_928839418 9 Left 928839412 2:35587235-35587257 CCAAGACTCCCAGTAAAAATAAA No data
Right 928839418 2:35587267-35587289 TTATTGGAACTAGTGGAAGAAGG No data
928839412_928839420 29 Left 928839412 2:35587235-35587257 CCAAGACTCCCAGTAAAAATAAA No data
Right 928839420 2:35587287-35587309 AGGTTAGCACTAGTATTGATGGG No data
928839412_928839417 2 Left 928839412 2:35587235-35587257 CCAAGACTCCCAGTAAAAATAAA No data
Right 928839417 2:35587260-35587282 AGGCAGCTTATTGGAACTAGTGG No data
928839412_928839416 -7 Left 928839412 2:35587235-35587257 CCAAGACTCCCAGTAAAAATAAA No data
Right 928839416 2:35587251-35587273 AAATAAACAAGGCAGCTTATTGG No data
928839412_928839421 30 Left 928839412 2:35587235-35587257 CCAAGACTCCCAGTAAAAATAAA No data
Right 928839421 2:35587288-35587310 GGTTAGCACTAGTATTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928839412 Original CRISPR TTTATTTTTACTGGGAGTCT TGG (reversed) Intergenic
No off target data available for this crispr