ID: 928839414

View in Genome Browser
Species Human (GRCh38)
Location 2:35587243-35587265
Sequence CTGCCTTGTTTATTTTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928839414_928839418 1 Left 928839414 2:35587243-35587265 CCCAGTAAAAATAAACAAGGCAG No data
Right 928839418 2:35587267-35587289 TTATTGGAACTAGTGGAAGAAGG No data
928839414_928839419 20 Left 928839414 2:35587243-35587265 CCCAGTAAAAATAAACAAGGCAG No data
Right 928839419 2:35587286-35587308 AAGGTTAGCACTAGTATTGATGG No data
928839414_928839420 21 Left 928839414 2:35587243-35587265 CCCAGTAAAAATAAACAAGGCAG No data
Right 928839420 2:35587287-35587309 AGGTTAGCACTAGTATTGATGGG No data
928839414_928839417 -6 Left 928839414 2:35587243-35587265 CCCAGTAAAAATAAACAAGGCAG No data
Right 928839417 2:35587260-35587282 AGGCAGCTTATTGGAACTAGTGG No data
928839414_928839421 22 Left 928839414 2:35587243-35587265 CCCAGTAAAAATAAACAAGGCAG No data
Right 928839421 2:35587288-35587310 GGTTAGCACTAGTATTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928839414 Original CRISPR CTGCCTTGTTTATTTTTACT GGG (reversed) Intergenic
No off target data available for this crispr