ID: 928839421

View in Genome Browser
Species Human (GRCh38)
Location 2:35587288-35587310
Sequence GGTTAGCACTAGTATTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928839414_928839421 22 Left 928839414 2:35587243-35587265 CCCAGTAAAAATAAACAAGGCAG No data
Right 928839421 2:35587288-35587310 GGTTAGCACTAGTATTGATGGGG No data
928839412_928839421 30 Left 928839412 2:35587235-35587257 CCAAGACTCCCAGTAAAAATAAA No data
Right 928839421 2:35587288-35587310 GGTTAGCACTAGTATTGATGGGG No data
928839415_928839421 21 Left 928839415 2:35587244-35587266 CCAGTAAAAATAAACAAGGCAGC No data
Right 928839421 2:35587288-35587310 GGTTAGCACTAGTATTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928839421 Original CRISPR GGTTAGCACTAGTATTGATG GGG Intergenic
No off target data available for this crispr