ID: 928840080

View in Genome Browser
Species Human (GRCh38)
Location 2:35595478-35595500
Sequence AGGTGCTGCAGCTGAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928840074_928840080 23 Left 928840074 2:35595432-35595454 CCAATCACTGAGACAACAAGTAT 0: 40
1: 71
2: 175
3: 236
4: 365
Right 928840080 2:35595478-35595500 AGGTGCTGCAGCTGAGCAGATGG No data
928840078_928840080 -2 Left 928840078 2:35595457-35595479 CCAGGGAAGAAGGTTGTATTCAG No data
Right 928840080 2:35595478-35595500 AGGTGCTGCAGCTGAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928840080 Original CRISPR AGGTGCTGCAGCTGAGCAGA TGG Intergenic
No off target data available for this crispr