ID: 928840080 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:35595478-35595500 |
Sequence | AGGTGCTGCAGCTGAGCAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
928840074_928840080 | 23 | Left | 928840074 | 2:35595432-35595454 | CCAATCACTGAGACAACAAGTAT | 0: 40 1: 71 2: 175 3: 236 4: 365 |
||
Right | 928840080 | 2:35595478-35595500 | AGGTGCTGCAGCTGAGCAGATGG | No data | ||||
928840078_928840080 | -2 | Left | 928840078 | 2:35595457-35595479 | CCAGGGAAGAAGGTTGTATTCAG | No data | ||
Right | 928840080 | 2:35595478-35595500 | AGGTGCTGCAGCTGAGCAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
928840080 | Original CRISPR | AGGTGCTGCAGCTGAGCAGA TGG | Intergenic | ||
No off target data available for this crispr |