ID: 928843798

View in Genome Browser
Species Human (GRCh38)
Location 2:35644318-35644340
Sequence TTTGGGGAACCACACTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928843790_928843798 -5 Left 928843790 2:35644300-35644322 CCAGCTTTCTTCCCTCAATTTGG No data
Right 928843798 2:35644318-35644340 TTTGGGGAACCACACTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928843798 Original CRISPR TTTGGGGAACCACACTGAAG GGG Intergenic
No off target data available for this crispr