ID: 928845087

View in Genome Browser
Species Human (GRCh38)
Location 2:35661832-35661854
Sequence CTGTATGAAATGGAGCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928845087_928845093 14 Left 928845087 2:35661832-35661854 CCACTTTGCTCCATTTCATACAG No data
Right 928845093 2:35661869-35661891 ATTTCTGTCATAATGTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928845087 Original CRISPR CTGTATGAAATGGAGCAAAG TGG (reversed) Intergenic
No off target data available for this crispr