ID: 928845093

View in Genome Browser
Species Human (GRCh38)
Location 2:35661869-35661891
Sequence ATTTCTGTCATAATGTTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928845087_928845093 14 Left 928845087 2:35661832-35661854 CCACTTTGCTCCATTTCATACAG No data
Right 928845093 2:35661869-35661891 ATTTCTGTCATAATGTTAATAGG No data
928845090_928845093 4 Left 928845090 2:35661842-35661864 CCATTTCATACAGGGCACAATTG No data
Right 928845093 2:35661869-35661891 ATTTCTGTCATAATGTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928845093 Original CRISPR ATTTCTGTCATAATGTTAAT AGG Intergenic
No off target data available for this crispr