ID: 928847087

View in Genome Browser
Species Human (GRCh38)
Location 2:35689267-35689289
Sequence ATGGTCTTCTGGAAGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928847087_928847094 23 Left 928847087 2:35689267-35689289 CCCTCTCTCTTCCAGAAGACCAT No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data
928847087_928847091 -3 Left 928847087 2:35689267-35689289 CCCTCTCTCTTCCAGAAGACCAT No data
Right 928847091 2:35689287-35689309 CATTTCTGCCATCCAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928847087 Original CRISPR ATGGTCTTCTGGAAGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr