ID: 928847091

View in Genome Browser
Species Human (GRCh38)
Location 2:35689287-35689309
Sequence CATTTCTGCCATCCAAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928847088_928847091 -4 Left 928847088 2:35689268-35689290 CCTCTCTCTTCCAGAAGACCATT No data
Right 928847091 2:35689287-35689309 CATTTCTGCCATCCAAAACTTGG No data
928847083_928847091 24 Left 928847083 2:35689240-35689262 CCCCAGAGGAACTGGACTGTGCG No data
Right 928847091 2:35689287-35689309 CATTTCTGCCATCCAAAACTTGG No data
928847086_928847091 -2 Left 928847086 2:35689266-35689288 CCCCTCTCTCTTCCAGAAGACCA No data
Right 928847091 2:35689287-35689309 CATTTCTGCCATCCAAAACTTGG No data
928847084_928847091 23 Left 928847084 2:35689241-35689263 CCCAGAGGAACTGGACTGTGCGT No data
Right 928847091 2:35689287-35689309 CATTTCTGCCATCCAAAACTTGG No data
928847087_928847091 -3 Left 928847087 2:35689267-35689289 CCCTCTCTCTTCCAGAAGACCAT No data
Right 928847091 2:35689287-35689309 CATTTCTGCCATCCAAAACTTGG No data
928847085_928847091 22 Left 928847085 2:35689242-35689264 CCAGAGGAACTGGACTGTGCGTT No data
Right 928847091 2:35689287-35689309 CATTTCTGCCATCCAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928847091 Original CRISPR CATTTCTGCCATCCAAAACT TGG Intergenic
No off target data available for this crispr