ID: 928847094

View in Genome Browser
Species Human (GRCh38)
Location 2:35689313-35689335
Sequence TGCAGACTGTTACACAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928847092_928847094 -5 Left 928847092 2:35689295-35689317 CCATCCAAAACTTGGCAGTGCAG No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data
928847087_928847094 23 Left 928847087 2:35689267-35689289 CCCTCTCTCTTCCAGAAGACCAT No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data
928847089_928847094 12 Left 928847089 2:35689278-35689300 CCAGAAGACCATTTCTGCCATCC No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data
928847088_928847094 22 Left 928847088 2:35689268-35689290 CCTCTCTCTTCCAGAAGACCATT No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data
928847093_928847094 -9 Left 928847093 2:35689299-35689321 CCAAAACTTGGCAGTGCAGACTG No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data
928847086_928847094 24 Left 928847086 2:35689266-35689288 CCCCTCTCTCTTCCAGAAGACCA No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data
928847090_928847094 4 Left 928847090 2:35689286-35689308 CCATTTCTGCCATCCAAAACTTG No data
Right 928847094 2:35689313-35689335 TGCAGACTGTTACACAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928847094 Original CRISPR TGCAGACTGTTACACAGTCA TGG Intergenic
No off target data available for this crispr