ID: 928847533

View in Genome Browser
Species Human (GRCh38)
Location 2:35695668-35695690
Sequence GCCTTCAAATAAATAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928847533_928847535 12 Left 928847533 2:35695668-35695690 CCTTGGGTTATTTATTTGAAGGC No data
Right 928847535 2:35695703-35695725 TTTTTAAATGTAGGCACTTATGG No data
928847533_928847534 3 Left 928847533 2:35695668-35695690 CCTTGGGTTATTTATTTGAAGGC No data
Right 928847534 2:35695694-35695716 TGTGTGTTTTTTTTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928847533 Original CRISPR GCCTTCAAATAAATAACCCA AGG (reversed) Intergenic
No off target data available for this crispr