ID: 928847610

View in Genome Browser
Species Human (GRCh38)
Location 2:35696689-35696711
Sequence AGGGAGAGCAAAGTGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928847610_928847623 30 Left 928847610 2:35696689-35696711 CCCCCAGTCACTTTGCTCTCCCT No data
Right 928847623 2:35696742-35696764 CATAGCTGCTGCTAGGAGATGGG No data
928847610_928847620 23 Left 928847610 2:35696689-35696711 CCCCCAGTCACTTTGCTCTCCCT No data
Right 928847620 2:35696735-35696757 TGCACCACATAGCTGCTGCTAGG No data
928847610_928847622 29 Left 928847610 2:35696689-35696711 CCCCCAGTCACTTTGCTCTCCCT No data
Right 928847622 2:35696741-35696763 ACATAGCTGCTGCTAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928847610 Original CRISPR AGGGAGAGCAAAGTGACTGG GGG (reversed) Intergenic
No off target data available for this crispr