ID: 928849300

View in Genome Browser
Species Human (GRCh38)
Location 2:35723856-35723878
Sequence ATAAGAAATCTGGCCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928849300_928849303 20 Left 928849300 2:35723856-35723878 CCTCATCTGGCCAGATTTCTTAT No data
Right 928849303 2:35723899-35723921 TTAGCTATTTTAACTTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928849300 Original CRISPR ATAAGAAATCTGGCCAGATG AGG (reversed) Intergenic
No off target data available for this crispr