ID: 928850014

View in Genome Browser
Species Human (GRCh38)
Location 2:35734396-35734418
Sequence TCCAGCTGGCCAGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928850006_928850014 17 Left 928850006 2:35734356-35734378 CCCACAACACCTCACAAATTAAG No data
Right 928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG No data
928850008_928850014 8 Left 928850008 2:35734365-35734387 CCTCACAAATTAAGACCCACTGG No data
Right 928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG No data
928850011_928850014 -7 Left 928850011 2:35734380-35734402 CCCACTGGCTTGGAATTCCAGCT 0: 13
1: 115
2: 177
3: 185
4: 331
Right 928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG No data
928850005_928850014 22 Left 928850005 2:35734351-35734373 CCACTCCCACAACACCTCACAAA No data
Right 928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG No data
928850012_928850014 -8 Left 928850012 2:35734381-35734403 CCACTGGCTTGGAATTCCAGCTG 0: 8
1: 25
2: 155
3: 773
4: 1053
Right 928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG No data
928850007_928850014 16 Left 928850007 2:35734357-35734379 CCACAACACCTCACAAATTAAGA No data
Right 928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928850014 Original CRISPR TCCAGCTGGCCAGCAGCAGC AGG Intergenic
No off target data available for this crispr