ID: 928859469

View in Genome Browser
Species Human (GRCh38)
Location 2:35839462-35839484
Sequence CCTTGTCCTTGCAATGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928859465_928859469 -6 Left 928859465 2:35839445-35839467 CCTGCTTTCTCCTGCAGCCTTGT No data
Right 928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG No data
928859464_928859469 -5 Left 928859464 2:35839444-35839466 CCCTGCTTTCTCCTGCAGCCTTG No data
Right 928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG No data
928859462_928859469 11 Left 928859462 2:35839428-35839450 CCCAAGCATGTGACTTCCCTGCT No data
Right 928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG No data
928859463_928859469 10 Left 928859463 2:35839429-35839451 CCAAGCATGTGACTTCCCTGCTT No data
Right 928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928859469 Original CRISPR CCTTGTCCTTGCAATGGTGC AGG Intergenic
No off target data available for this crispr