ID: 928865732

View in Genome Browser
Species Human (GRCh38)
Location 2:35915761-35915783
Sequence CACACTGCAGAGAGGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928865732_928865735 -8 Left 928865732 2:35915761-35915783 CCTAATTCCCTCTCTGCAGTGTG No data
Right 928865735 2:35915776-35915798 GCAGTGTGCGCACACACATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928865732 Original CRISPR CACACTGCAGAGAGGGAATT AGG (reversed) Intergenic
No off target data available for this crispr