ID: 928877237

View in Genome Browser
Species Human (GRCh38)
Location 2:36054225-36054247
Sequence GCTGCTGGTATGGCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928877234_928877237 -8 Left 928877234 2:36054210-36054232 CCGAGGAATGGCAAGGCTGCTGG No data
Right 928877237 2:36054225-36054247 GCTGCTGGTATGGCAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928877237 Original CRISPR GCTGCTGGTATGGCAAAACC AGG Intergenic
No off target data available for this crispr