ID: 928879173

View in Genome Browser
Species Human (GRCh38)
Location 2:36077909-36077931
Sequence GCAACTCAACATTTGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928879173_928879177 -1 Left 928879173 2:36077909-36077931 CCAAATGCCAAATGTTGAGTTGC No data
Right 928879177 2:36077931-36077953 CTAAAATAGATGAGGGTTACTGG No data
928879173_928879176 -8 Left 928879173 2:36077909-36077931 CCAAATGCCAAATGTTGAGTTGC No data
Right 928879176 2:36077924-36077946 TGAGTTGCTAAAATAGATGAGGG No data
928879173_928879175 -9 Left 928879173 2:36077909-36077931 CCAAATGCCAAATGTTGAGTTGC No data
Right 928879175 2:36077923-36077945 TTGAGTTGCTAAAATAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928879173 Original CRISPR GCAACTCAACATTTGGCATT TGG (reversed) Intergenic
No off target data available for this crispr