ID: 928879176

View in Genome Browser
Species Human (GRCh38)
Location 2:36077924-36077946
Sequence TGAGTTGCTAAAATAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928879172_928879176 1 Left 928879172 2:36077900-36077922 CCAGTAAGTCCAAATGCCAAATG No data
Right 928879176 2:36077924-36077946 TGAGTTGCTAAAATAGATGAGGG No data
928879173_928879176 -8 Left 928879173 2:36077909-36077931 CCAAATGCCAAATGTTGAGTTGC No data
Right 928879176 2:36077924-36077946 TGAGTTGCTAAAATAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928879176 Original CRISPR TGAGTTGCTAAAATAGATGA GGG Intergenic
No off target data available for this crispr