ID: 928882313

View in Genome Browser
Species Human (GRCh38)
Location 2:36111083-36111105
Sequence ACTGATATCCAGAATGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9601
Summary {0: 3, 1: 43, 2: 989, 3: 3864, 4: 4702}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928882313_928882316 24 Left 928882313 2:36111083-36111105 CCCTGTACATTCTGGATATCAGT 0: 3
1: 43
2: 989
3: 3864
4: 4702
Right 928882316 2:36111130-36111152 AATATTATCTCCCATTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928882313 Original CRISPR ACTGATATCCAGAATGTACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr