ID: 928882370

View in Genome Browser
Species Human (GRCh38)
Location 2:36112342-36112364
Sequence TTTAGGCACTTCATGTGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928882370_928882371 -9 Left 928882370 2:36112342-36112364 CCTAGACACATGAAGTGCCTAAA No data
Right 928882371 2:36112356-36112378 GTGCCTAAATGTCTACCAACAGG No data
928882370_928882374 13 Left 928882370 2:36112342-36112364 CCTAGACACATGAAGTGCCTAAA No data
Right 928882374 2:36112378-36112400 GACAATGCATAAGTAAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928882370 Original CRISPR TTTAGGCACTTCATGTGTCT AGG (reversed) Intergenic
No off target data available for this crispr