ID: 928885349

View in Genome Browser
Species Human (GRCh38)
Location 2:36142183-36142205
Sequence TTGTACATGCATATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928885349_928885353 8 Left 928885349 2:36142183-36142205 CCTTCCTCCATATGCATGTACAA No data
Right 928885353 2:36142214-36142236 TCTCAGTGCAACCCAGAAGAGGG No data
928885349_928885352 7 Left 928885349 2:36142183-36142205 CCTTCCTCCATATGCATGTACAA No data
Right 928885352 2:36142213-36142235 CTCTCAGTGCAACCCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928885349 Original CRISPR TTGTACATGCATATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr