ID: 928889654

View in Genome Browser
Species Human (GRCh38)
Location 2:36188980-36189002
Sequence GTGTCCTGCTGATCTGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928889654_928889658 2 Left 928889654 2:36188980-36189002 CCCATACCAGATCAGCAGGACAC No data
Right 928889658 2:36189005-36189027 GTAGATGCAGCCAAGAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928889654 Original CRISPR GTGTCCTGCTGATCTGGTAT GGG (reversed) Intergenic