ID: 928897736

View in Genome Browser
Species Human (GRCh38)
Location 2:36284176-36284198
Sequence TATCCTTAACAAACTAATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9484
Summary {0: 27, 1: 797, 2: 1881, 3: 2913, 4: 3866}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928897736_928897742 17 Left 928897736 2:36284176-36284198 CCCGCATTAGTTTGTTAAGGATA 0: 27
1: 797
2: 1881
3: 2913
4: 3866
Right 928897742 2:36284216-36284238 CCATTTCCCTGCAAAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928897736 Original CRISPR TATCCTTAACAAACTAATGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr