ID: 928897737

View in Genome Browser
Species Human (GRCh38)
Location 2:36284177-36284199
Sequence TTATCCTTAACAAACTAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928897737_928897742 16 Left 928897737 2:36284177-36284199 CCGCATTAGTTTGTTAAGGATAA No data
Right 928897742 2:36284216-36284238 CCATTTCCCTGCAAAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928897737 Original CRISPR TTATCCTTAACAAACTAATG CGG (reversed) Intergenic
No off target data available for this crispr