ID: 928897739

View in Genome Browser
Species Human (GRCh38)
Location 2:36284203-36284225
Sequence AGGGAAATGGATGGAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928897739_928897746 26 Left 928897739 2:36284203-36284225 CCTTCAGCTCCATCCATTTCCCT No data
Right 928897746 2:36284252-36284274 AATGGCTGTATAGTATTCCATGG No data
928897739_928897742 -10 Left 928897739 2:36284203-36284225 CCTTCAGCTCCATCCATTTCCCT No data
Right 928897742 2:36284216-36284238 CCATTTCCCTGCAAAGAACGTGG No data
928897739_928897745 8 Left 928897739 2:36284203-36284225 CCTTCAGCTCCATCCATTTCCCT No data
Right 928897745 2:36284234-36284256 CGTGGTCTCATTCTTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928897739 Original CRISPR AGGGAAATGGATGGAGCTGA AGG (reversed) Intergenic
No off target data available for this crispr