ID: 928897742

View in Genome Browser
Species Human (GRCh38)
Location 2:36284216-36284238
Sequence CCATTTCCCTGCAAAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928897737_928897742 16 Left 928897737 2:36284177-36284199 CCGCATTAGTTTGTTAAGGATAA No data
Right 928897742 2:36284216-36284238 CCATTTCCCTGCAAAGAACGTGG No data
928897739_928897742 -10 Left 928897739 2:36284203-36284225 CCTTCAGCTCCATCCATTTCCCT No data
Right 928897742 2:36284216-36284238 CCATTTCCCTGCAAAGAACGTGG No data
928897736_928897742 17 Left 928897736 2:36284176-36284198 CCCGCATTAGTTTGTTAAGGATA 0: 27
1: 797
2: 1881
3: 2913
4: 3866
Right 928897742 2:36284216-36284238 CCATTTCCCTGCAAAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928897742 Original CRISPR CCATTTCCCTGCAAAGAACG TGG Intergenic
No off target data available for this crispr