ID: 928898152

View in Genome Browser
Species Human (GRCh38)
Location 2:36288486-36288508
Sequence ATGTATGTCCAAAAGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928898151_928898152 -8 Left 928898151 2:36288471-36288493 CCTATGTACTGAAGGATGTATGT No data
Right 928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG No data
928898150_928898152 -7 Left 928898150 2:36288470-36288492 CCCTATGTACTGAAGGATGTATG No data
Right 928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG No data
928898148_928898152 23 Left 928898148 2:36288440-36288462 CCTTGGTGTTACAGTCAGTGGAA No data
Right 928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928898152 Original CRISPR ATGTATGTCCAAAAGAAAGT TGG Intergenic
No off target data available for this crispr