ID: 928898418

View in Genome Browser
Species Human (GRCh38)
Location 2:36292147-36292169
Sequence CTGAGTTATATCTACATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928898415_928898418 8 Left 928898415 2:36292116-36292138 CCCTTACTCCTTGGAATGACTGA No data
Right 928898418 2:36292147-36292169 CTGAGTTATATCTACATGCCTGG No data
928898416_928898418 7 Left 928898416 2:36292117-36292139 CCTTACTCCTTGGAATGACTGAT No data
Right 928898418 2:36292147-36292169 CTGAGTTATATCTACATGCCTGG No data
928898414_928898418 9 Left 928898414 2:36292115-36292137 CCCCTTACTCCTTGGAATGACTG No data
Right 928898418 2:36292147-36292169 CTGAGTTATATCTACATGCCTGG No data
928898417_928898418 0 Left 928898417 2:36292124-36292146 CCTTGGAATGACTGATTTTCAGT No data
Right 928898418 2:36292147-36292169 CTGAGTTATATCTACATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928898418 Original CRISPR CTGAGTTATATCTACATGCC TGG Intergenic
No off target data available for this crispr