ID: 928898915

View in Genome Browser
Species Human (GRCh38)
Location 2:36296994-36297016
Sequence GCCCGTGCCCTCATCCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928898908_928898915 -5 Left 928898908 2:36296976-36296998 CCTCTGCCCAGGTGTTAAGCCCG No data
Right 928898915 2:36296994-36297016 GCCCGTGCCCTCATCCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928898915 Original CRISPR GCCCGTGCCCTCATCCTGGG GGG Intergenic
No off target data available for this crispr