ID: 928903348

View in Genome Browser
Species Human (GRCh38)
Location 2:36344691-36344713
Sequence GGGATAGGGCTCTGTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928903348_928903356 23 Left 928903348 2:36344691-36344713 CCCAGGCCACAGAGCCCTATCCC No data
Right 928903356 2:36344737-36344759 ATGTTAGAATGCACACAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928903348 Original CRISPR GGGATAGGGCTCTGTGGCCT GGG (reversed) Intergenic