ID: 928906477

View in Genome Browser
Species Human (GRCh38)
Location 2:36373517-36373539
Sequence CTGTACCCAAAGATGGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928906474_928906477 -7 Left 928906474 2:36373501-36373523 CCTATCGTTCCTACAGCTGTACC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG 0: 1
1: 0
2: 3
3: 14
4: 139
928906472_928906477 8 Left 928906472 2:36373486-36373508 CCAGCCTTTGACTGGCCTATCGT 0: 1
1: 0
2: 0
3: 2
4: 59
Right 928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG 0: 1
1: 0
2: 3
3: 14
4: 139
928906473_928906477 4 Left 928906473 2:36373490-36373512 CCTTTGACTGGCCTATCGTTCCT 0: 1
1: 0
2: 0
3: 2
4: 83
Right 928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG 0: 1
1: 0
2: 3
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928906477 Original CRISPR CTGTACCCAAAGATGGCACT TGG Intronic
904479113 1:30783060-30783082 CTGTACCCAAACCTGGCTCCAGG - Intergenic
905208876 1:36359529-36359551 AAGTCCCCAAAGCTGGCACTTGG - Intronic
906345006 1:45009597-45009619 CCGTACCCAGTGTTGGCACTGGG + Exonic
913404838 1:118478194-118478216 ATGTACTCAAAGGTGGCAGTTGG + Intergenic
914781761 1:150792009-150792031 CTGTAACCAAATAAGGCCCTGGG + Intergenic
917107906 1:171513115-171513137 TTGTACCTAAAGATGGCACAGGG + Exonic
917577316 1:176337442-176337464 GTGTACACAAAGATCTCACTGGG + Intergenic
918533535 1:185549367-185549389 CTGTCTCCATAAATGGCACTTGG - Intergenic
919647217 1:200107075-200107097 CTGCACCCACAGCTGGCCCTTGG - Intronic
919807104 1:201386612-201386634 CTGGCCCCAGGGATGGCACTGGG - Exonic
921078921 1:211723321-211723343 CTTTACCCAGAGATGACACATGG - Intergenic
923605807 1:235441418-235441440 CTGTTACCAAAGGTGACACTCGG + Intronic
1063946423 10:11180570-11180592 CTATACCCAGAGCTGTCACTGGG - Intronic
1068039402 10:51804032-51804054 CTGTGCCCAAAGTTGCCACGTGG - Intronic
1068605547 10:59001112-59001134 CTTTACCCAAAAATGTAACTTGG + Intergenic
1075300091 10:121314555-121314577 CTGTACCCAGAGGAGGCACTGGG - Intergenic
1076714098 10:132354574-132354596 CTGTGCCCTGAGGTGGCACTGGG + Intronic
1076789503 10:132769295-132769317 CTGTCCCTAAAGAAGGCGCTAGG - Intronic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1084315388 11:68342687-68342709 CTGTGCCCACAGATGTCCCTGGG + Intronic
1085572052 11:77568418-77568440 GTGTGTCCAAAGATGCCACTGGG + Intronic
1087267149 11:96073050-96073072 CTGTTCCCTAAGATTGTACTTGG - Intronic
1090366000 11:126206248-126206270 CTGTACCCGAAGAAGTCACAGGG + Intronic
1095389284 12:41686731-41686753 TTGAACCCAAGGAAGGCACTAGG - Intergenic
1095885008 12:47179285-47179307 CTGTTCTCAAAGATGACACAAGG + Intronic
1096679150 12:53243215-53243237 CTGTCCCCAGGGATGGGACTGGG + Intergenic
1097178294 12:57156317-57156339 CTTTACCCCATGATGGCTCTGGG + Intronic
1099374323 12:81879381-81879403 CTGTACTCAGATATGTCACTGGG + Intergenic
1101197638 12:102401506-102401528 CTGGAGCCAAAGATGACACAAGG - Intronic
1101523403 12:105505647-105505669 CTGATCACAAAGATGGCACCTGG + Intergenic
1104370709 12:128221599-128221621 CTCTATCACAAGATGGCACTAGG - Intergenic
1105245211 13:18643997-18644019 CTGCACCCTATGAGGGCACTAGG + Intergenic
1105882571 13:24616839-24616861 CTGTCCCCGAGGCTGGCACTGGG - Intergenic
1106553688 13:30792346-30792368 CTGTACATAAAGATGACACTGGG + Intergenic
1109525331 13:63567132-63567154 CAGCTCCCACAGATGGCACTGGG - Intergenic
1111068370 13:83128590-83128612 CTGCACCCAAAAAAGGCACAGGG + Intergenic
1112446888 13:99472270-99472292 CAGCACCCAAAGAAGGAACTGGG - Intergenic
1113022010 13:105897570-105897592 CTGTTACCAAAGATTGCAATAGG - Intergenic
1113094451 13:106649190-106649212 CTGTACACAAACGTGGCTCTTGG - Intergenic
1113352802 13:109546020-109546042 CTGTTCCAAAAGATGGCATGGGG - Intergenic
1113932891 13:113977571-113977593 CTGTCACCAGAGATGTCACTTGG + Intergenic
1115851006 14:37590549-37590571 CTCTACCCACAGATGGCCCTGGG - Exonic
1118574866 14:67232093-67232115 CTGTACCCAAAGGAAGCAATAGG - Intergenic
1120314769 14:82877225-82877247 CTTTAGCCAAAGATTGCAGTGGG + Intergenic
1121366572 14:93317674-93317696 CTGCATGCAAAGATGGCCCTTGG + Intronic
1121726656 14:96157192-96157214 CTGGTCCAAAAGATGGCTCTTGG - Intergenic
1124354458 15:28984637-28984659 CAGCACCCAGAGATGGCAGTGGG - Intronic
1125588449 15:40839050-40839072 CTTTTCCCAAAGTTTGCACTGGG + Intergenic
1131629326 15:94159243-94159265 CTGTACCCAAAGAAGGCAGTAGG - Intergenic
1132232606 15:100195060-100195082 CTGAACCCAAAGGTAGCACATGG + Intronic
1133103652 16:3493811-3493833 CTGTACCCAGTCCTGGCACTCGG + Exonic
1134442664 16:14308460-14308482 CTGAACCAAGAGATGGCACCTGG + Intergenic
1136248696 16:28989762-28989784 CTGTCCCCACAGATGGCAGCCGG + Exonic
1136490958 16:30608113-30608135 CTGAATCCAAAGCGGGCACTAGG - Intronic
1139601101 16:67987755-67987777 CTGTACCTAGAGGTGGCAGTCGG + Exonic
1140212770 16:72983839-72983861 CTGTACCCACACTTGGCAGTGGG - Intronic
1142621582 17:1168868-1168890 CTACACCCAAAGATGGCACTTGG + Intronic
1143039391 17:4022225-4022247 CTGGGCCGAAAGTTGGCACTGGG + Intronic
1143073853 17:4322402-4322424 CTCTTCCCTAAGATGGCATTAGG + Intronic
1148070470 17:44905816-44905838 CTGTGCCCAGAGATGGGACTGGG - Intronic
1152401872 17:80071300-80071322 CTTTACCCCAAGATGTGACTCGG + Intronic
1152765492 17:82135565-82135587 AAGAACCCAAAGATGACACTTGG + Intronic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1157245658 18:46052050-46052072 CTATACCCAAAACTGGAACTAGG + Intronic
1157627365 18:49061667-49061689 CAGGACCCAAAGATGACAGTGGG + Intronic
1160800189 19:964089-964111 CTGCACCCACAGAGGGCCCTGGG + Intronic
1161691322 19:5736226-5736248 CTGTCCCCCAAGAGGACACTTGG + Intronic
1162759248 19:12878835-12878857 CTGGACCAAAAGAAGGCATTAGG + Intronic
1164302160 19:23972108-23972130 CTGGACTCAACGATGGCACCCGG + Intergenic
1165662676 19:37595246-37595268 CTGCACCCACAGAGGACACTCGG - Intronic
1167645554 19:50703361-50703383 CTTTACCCCAAGGTGACACTAGG + Intronic
925944833 2:8851105-8851127 CTGTACCAAAAGATACAACTGGG + Intergenic
928514657 2:32034493-32034515 CATTACCAAAAGATGGCACCAGG + Intronic
928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG + Intronic
931707352 2:64958137-64958159 CTTTACCCCAAGAAGGCTCTTGG + Intergenic
931854787 2:66291755-66291777 CTATACCCAAGCATGGCTCTAGG + Intergenic
933343380 2:81050740-81050762 CTGTATCCAAGGCTGGCACACGG - Intergenic
940408254 2:153330154-153330176 CAGTAACCAAAAATGGCAGTTGG - Intergenic
943952969 2:194154780-194154802 CTGAACCCAAAGAATGGACTTGG + Intergenic
945825075 2:214711838-214711860 ATGTTCCCAATGCTGGCACTTGG - Intergenic
946039946 2:216774815-216774837 CTGTACTCAGAGCTGGCCCTGGG - Intergenic
949078246 2:242075083-242075105 CTGATCCCCAAGTTGGCACTTGG - Intergenic
1174542882 20:51303769-51303791 CTGTTCCAAAAGCTGGCACAGGG + Intergenic
1178563442 21:33660722-33660744 CTGTACCAAAACTTGACACTGGG + Intronic
1182740617 22:32564674-32564696 CTGCACCCAAAGAGTGCTCTCGG + Intronic
950019981 3:9780282-9780304 CTGTGCCCAAAGAAGGAAGTGGG + Exonic
950252285 3:11475797-11475819 CTGTACCCTAAGTAGGCAGTTGG + Intronic
951649310 3:24932020-24932042 AGGTATCCAAAGATGGAACTTGG - Intergenic
955796303 3:62640705-62640727 TTGAAACCAAAGATGCCACTTGG - Intronic
956075841 3:65504531-65504553 CTGTACACAAAGAAGACATTGGG + Intronic
959279092 3:104315799-104315821 CTCTATCCAGAGATAGCACTAGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962885076 3:139617153-139617175 CTGTTCACACTGATGGCACTGGG + Intronic
969148422 4:5144493-5144515 CTGGACACAAATATGGTACTGGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969436258 4:7191367-7191389 CTGTACCCAGCGCTGGGACTTGG - Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
974602857 4:64108523-64108545 CTTTACACAAACATGGCAGTTGG + Intergenic
975525484 4:75344196-75344218 CAGTATCCAAAGATGACATTGGG + Intergenic
978218291 4:106235406-106235428 CTAGACTAAAAGATGGCACTAGG - Intronic
979488850 4:121300928-121300950 TGGAACCCAAAGATGGCAATAGG + Intergenic
980495636 4:133585587-133585609 TTGTTCCCCAAGATGGCACTGGG - Intergenic
982375975 4:154691102-154691124 ATGTACCCAAAGATAACACTAGG - Intronic
985790492 5:1924362-1924384 CAGTCCCCCAAGAAGGCACTGGG - Intergenic
991731772 5:69596668-69596690 CTGGATCCAAAGCAGGCACTAGG - Intergenic
991808204 5:70451806-70451828 CTGGATCCAAAGCAGGCACTAGG - Intergenic
991863180 5:71031199-71031221 CTGGATCCAAAGCAGGCACTAGG + Intergenic
994507015 5:100656406-100656428 CTGTACCTAAAGGTAGCACTAGG + Intergenic
997214417 5:132098576-132098598 CCATATCCAAAGATGGCCCTTGG + Intergenic
998529528 5:142871893-142871915 CTACACCAAAAGAAGGCACTTGG - Intronic
1000111378 5:158111485-158111507 CTTTACCCCATGATGTCACTCGG + Intergenic
1002323630 5:178390561-178390583 AGGTGCCCACAGATGGCACTGGG - Intronic
1003908805 6:10725330-10725352 TTGAGCCCAGAGATGGCACTTGG - Intronic
1006228922 6:32565266-32565288 CTGTAACCAAGGAAGTCACTGGG - Intronic
1006616097 6:35328078-35328100 CTGTACCCACAGGTGGCAGCTGG - Intergenic
1007577602 6:42936040-42936062 GTGGACCCAGAGATGGGACTGGG - Intronic
1008422624 6:51319960-51319982 CTCTAGCCATATATGGCACTAGG + Intergenic
1008795167 6:55294169-55294191 CTGTATGCAAAGATGGGACTCGG - Intergenic
1015499373 6:133916357-133916379 CTGTACTAAGAGATGGCACTAGG - Intergenic
1018172780 6:161154945-161154967 CTGTACCCGGAGATCCCACTGGG - Intronic
1021517051 7:21500904-21500926 CTGAACCCAAAGACTGCACTTGG + Intronic
1022469027 7:30670629-30670651 CTGTGGCCAATGAGGGCACTGGG + Intronic
1022530492 7:31063916-31063938 ATGTCCCCAAAAATGGCCCTTGG + Intronic
1023610187 7:41964898-41964920 CTGCCCCCAAAGCTGGCACATGG + Exonic
1025107680 7:56185797-56185819 CTGCACCCCAAGATGGTGCTGGG + Intergenic
1026310568 7:69180291-69180313 CTGCACCCCAAGATGGTGCTGGG - Intergenic
1031912356 7:127531668-127531690 CTGAACCCAAAGATCCAACTGGG + Intergenic
1032016740 7:128384817-128384839 CATAACACAAAGATGGCACTTGG - Intergenic
1032461131 7:132112358-132112380 CTGTACCCAAGGATGCCTCAAGG - Intergenic
1036462859 8:8969526-8969548 CTGTTCTAAAAGATGGAACTTGG + Intergenic
1036508618 8:9379731-9379753 CTGCACCCAGAGATGGCCCTCGG + Intergenic
1038993282 8:32893206-32893228 CTCTGCACAAACATGGCACTTGG - Intergenic
1041205401 8:55494232-55494254 CAGCACCCACAGCTGGCACTAGG + Intronic
1042960923 8:74302846-74302868 CTCTGTCCAAATATGGCACTAGG - Intronic
1046745905 8:117875694-117875716 CTCTCCCCAAAGATGGTACTTGG - Intronic
1048252174 8:132875881-132875903 CTGTGCCCAGAGAAGTCACTGGG - Intronic
1049592962 8:143470982-143471004 CGGTGCCCAGAGCTGGCACTGGG - Intronic
1051840315 9:21389495-21389517 CTAAACCCAAAGCTGGCACAAGG + Intergenic
1052932857 9:34069939-34069961 CTGGAGTCAGAGATGGCACTAGG - Intergenic
1057713077 9:97464734-97464756 CTGGAACCAAAGATGGCAGCAGG + Intronic
1061056523 9:128225641-128225663 CTGTGGACAAAGACGGCACTGGG + Intronic
1061954362 9:133953825-133953847 CTGTCTCCAAAGAAGGCACCTGG + Intronic
1062122398 9:134840883-134840905 CCGTTCCCAAAGATGGTATTAGG - Intronic
1062547195 9:137069159-137069181 CTGTTCCCAAGGCAGGCACTGGG + Intronic
1186317313 X:8385088-8385110 CTCTACCCACAGATGCCAGTGGG - Intergenic
1189182145 X:39014750-39014772 CTGAACCCAAACATTTCACTAGG - Intergenic
1191126868 X:56965719-56965741 CTATAATCAAAAATGGCACTGGG + Intergenic
1195002865 X:100658912-100658934 CTGTACCCAAAGAATGCCCATGG - Intronic
1195491716 X:105478264-105478286 CTCTACCCAAAGATGCCAGTAGG - Intronic
1198046367 X:132907215-132907237 CTGTACCCCTAGATAGCACAGGG - Intronic
1199293836 X:146135229-146135251 CTGTGCCCAGAAATAGCACTAGG - Intergenic
1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG + Exonic
1199614621 X:149647144-149647166 CTGTATCCAAAGCTGCGACTTGG - Intergenic
1199614636 X:149647225-149647247 CTGTATCCAAAGCTGCGACTTGG - Intergenic
1199631012 X:149776600-149776622 CGGTACCCAGAGATGGCAAAAGG - Exonic
1199676834 X:150196351-150196373 CTCTACTCCCAGATGGCACTGGG - Intergenic
1200939415 Y:8766519-8766541 CTGTACCCATATATCGCAGTTGG + Intergenic