ID: 928909052

View in Genome Browser
Species Human (GRCh38)
Location 2:36400318-36400340
Sequence ATGATGTAGTTGATTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928909052 Original CRISPR ATGATGTAGTTGATTGAAGA GGG Intronic
902674911 1:18001990-18002012 ATGATGTAGTAGAGTTAAGGAGG + Intergenic
902782817 1:18715789-18715811 ATGAGGTAGCTGTTTGCAGATGG + Intronic
906244859 1:44266172-44266194 TTGATGTAGGTGTGTGAAGAGGG + Intronic
907884622 1:58581298-58581320 ATAATGTAGTTGAAAGAAAATGG + Intergenic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
908580539 1:65511660-65511682 AAGAGGTAGTTGAATGAACAGGG + Intronic
909331960 1:74424345-74424367 AGACTGTAGTGGATTGAAGAGGG + Intronic
914977169 1:152377323-152377345 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
917231755 1:172845285-172845307 AGGATGTAGATGAGTGCAGAGGG - Intergenic
917250312 1:173052458-173052480 AAGAAGTAGTTTATTGAACAAGG - Intergenic
919571885 1:199259360-199259382 ATGATGCTGTTGAGTGAAGAAGG - Intergenic
922300113 1:224291706-224291728 ATGATGTTTTTGACTTAAGATGG - Intronic
922853281 1:228752680-228752702 ATAATGAAGCTGATTAAAGAGGG + Intergenic
923936449 1:238765587-238765609 ATGATGAAGCTTAGTGAAGAAGG - Intergenic
924667436 1:246087870-246087892 ATGATGTAGTTGGTTAGAGTTGG - Intronic
1065024680 10:21528764-21528786 GTTATGTAGTTGATAGTAGAAGG + Intergenic
1068222580 10:54063379-54063401 ATGCTGAAGTTGACTCAAGAAGG - Intronic
1068708591 10:60105660-60105682 TTGATGTATGTGATTAAAGATGG + Intronic
1071311680 10:84348634-84348656 ATGATGGAGTAGGTTGAGGAGGG + Intronic
1071377224 10:85019629-85019651 ATGAAAGAGTTGATAGAAGATGG - Intergenic
1076489389 10:130846734-130846756 GTAATGTACTTGATTGAAGCTGG - Intergenic
1077572866 11:3354666-3354688 AGGATTTAGTTTTTTGAAGAAGG + Intronic
1077711890 11:4545570-4545592 ATGACGTAGTGGGTTGCAGATGG - Exonic
1078853560 11:15187366-15187388 AGGATGCAGTAGATTAAAGATGG - Intronic
1078957132 11:16211608-16211630 AGAATGTAGTTGTATGAAGAGGG + Intronic
1079667215 11:23120991-23121013 ATGATGTATTGGATTGAAATAGG + Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1084050057 11:66593505-66593527 ATGAAGAAGGTGCTTGAAGAGGG + Intronic
1086156608 11:83673531-83673553 ATGAGGTTGTTGATGGTAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088042072 11:105398422-105398444 ATGTTGTAGATGGTTGTAGACGG - Intergenic
1090372299 11:126265006-126265028 ATGGTGCAGTTGTTTGAAAAGGG - Exonic
1091290232 11:134435411-134435433 ATGGTGGATTTGATAGAAGAAGG - Intergenic
1091496544 12:977960-977982 ATGATCAAGTTGAGTGAATATGG + Intronic
1092769276 12:11882055-11882077 ATGGTGTTGTTGTTTTAAGAAGG + Intronic
1093667874 12:21835908-21835930 ATGATGTGGAGGATTGGAGAAGG - Intronic
1098075396 12:66724446-66724468 ATGATGTATTTGATGAAATAAGG - Intronic
1098386311 12:69922583-69922605 ATAATCTAGTTGGTGGAAGAGGG - Intronic
1099247140 12:80206320-80206342 ATAATGTAGTTAGTTGAAAAAGG + Intergenic
1099503106 12:83437880-83437902 ATGATTAAGCTTATTGAAGAAGG - Intergenic
1099995472 12:89773405-89773427 ATGATGTCTTAGCTTGAAGACGG + Intergenic
1100914366 12:99402241-99402263 ATGATGTAGTTGAAAGATGAAGG + Intronic
1102282077 12:111626367-111626389 TTGTTGTTGTTGATTAAAGACGG + Intergenic
1104143318 12:126008853-126008875 ATGAATTACTTGATTGAGGAGGG + Intergenic
1104730088 12:131100377-131100399 ATGGTGAAGTTGGTTGATGATGG + Intronic
1104730096 12:131100424-131100446 ATGGTGGAGTTGGTTGATGATGG + Intronic
1110830767 13:80028252-80028274 ATGATGTAATTAATGGAACATGG - Intergenic
1111135132 13:84031787-84031809 ATGATTAAGTTTAGTGAAGAAGG - Intergenic
1112604348 13:100889501-100889523 ATCTTGTACTTGATTGAAAAAGG + Intergenic
1112625841 13:101102662-101102684 ATGCTGAAGTTAATTGAAGTGGG + Intronic
1118315261 14:64722138-64722160 ATGATGTAGTTGAGGGATGAAGG + Intronic
1118639412 14:67778363-67778385 ATGATGAAAATGATTGAAGCAGG + Intronic
1120679950 14:87469050-87469072 ATGACATAGTAAATTGAAGATGG - Intergenic
1125693128 15:41612802-41612824 ATGATGTGGTGGAATAAAGATGG - Intergenic
1126210366 15:46094529-46094551 AGGATATACTTGGTTGAAGAGGG - Intergenic
1126213246 15:46124620-46124642 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
1126218438 15:46184193-46184215 ATGATGTGGAGGCTTGAAGATGG - Intergenic
1126465178 15:48955303-48955325 ATGATGTAAGTGAGTGAAGCTGG + Intronic
1126565089 15:50088410-50088432 AGGCTGGAGTTGAATGAAGATGG - Intronic
1127153207 15:56100087-56100109 ATGATATAATTGAGTGAAGCTGG + Intronic
1127316375 15:57797978-57798000 ATGTTGTAGTTATTTGAAGTTGG + Intergenic
1129896424 15:79111124-79111146 ATGAAACAGTTGATTGCAGAGGG + Intergenic
1130072425 15:80659010-80659032 ATTATGGAGTTTATTGAAAAAGG + Intergenic
1130199423 15:81811153-81811175 ATAAGGTAGCTGATTGAGGAAGG + Intergenic
1130898926 15:88192513-88192535 ATAATGTAGATTGTTGAAGAGGG - Intronic
1132088935 15:98931938-98931960 ATGATGGAATTGATAGAACAAGG + Intronic
1133886460 16:9832831-9832853 AGTATCTGGTTGATTGAAGATGG + Intronic
1135187219 16:20325629-20325651 ATGCTGTAGATGCCTGAAGAAGG + Intronic
1135198747 16:20418439-20418461 ATGATGTAATTGATAAAAGCAGG + Intronic
1136527002 16:30837719-30837741 ATGAGTTAGTTTATTGAAGAGGG + Intronic
1138794980 16:59956786-59956808 GTGATGTAGGTGATGGAAGAAGG - Intergenic
1138928694 16:61624583-61624605 ATGATGTTGTTGGTTGAAGGGGG + Intergenic
1140193752 16:72839645-72839667 AAGCTGGAGTTGATAGAAGAAGG + Intronic
1145225757 17:21126953-21126975 AGGATGAAGTTGATTGACTATGG + Exonic
1146115483 17:30133982-30134004 ATGATTAAGCTGATTGAGGAAGG - Intronic
1146923615 17:36729608-36729630 ATGAGATAGTTTATAGAAGAAGG + Intergenic
1147759840 17:42790418-42790440 ATGATGAGCTTGAGTGAAGAAGG + Intronic
1149186218 17:54000933-54000955 GTGATGTAATGGATTGAAGTAGG + Intergenic
1153834757 18:8954037-8954059 ATGATGTAATTGCTTGAGTATGG - Intergenic
1154069550 18:11141061-11141083 AAGATGTAGGTGATTGGAGCGGG - Intronic
1155235998 18:23819878-23819900 ATGAAGTATGAGATTGAAGACGG + Exonic
1160533764 18:79580414-79580436 ATGATGTAGATGCTGCAAGAAGG + Intergenic
1163550029 19:17961255-17961277 CAGATGTAGTTAAATGAAGAGGG - Intronic
1165972685 19:39645827-39645849 ATGATGTATTTGCTGGGAGAAGG - Intergenic
1168585431 19:57587915-57587937 AGAAGGTTGTTGATTGAAGAGGG + Intronic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928539053 2:32267175-32267197 AAGATGTACTTGAATGAATATGG - Intergenic
928909052 2:36400318-36400340 ATGATGTAGTTGATTGAAGAGGG + Intronic
929538354 2:42799686-42799708 ATGATGTGTTTTAATGAAGAAGG - Intergenic
929742314 2:44615553-44615575 ATGATGCAGTTCACTGAGGAGGG + Intronic
929760758 2:44804460-44804482 TTGATGCACTTGTTTGAAGAGGG + Intergenic
930236108 2:48890235-48890257 ATGATGTAGTTAGTAGAAGTTGG + Intergenic
930729627 2:54715274-54715296 ATGATTTATTTTACTGAAGATGG - Intergenic
931017376 2:57999158-57999180 GTGACGAAGTTGATTTAAGATGG - Intronic
931590022 2:63872671-63872693 TTGATGTAGTTTATTGAATCGGG + Intronic
932033339 2:68213252-68213274 ATGATGAAGCTTATTGAGGAAGG - Intronic
934681953 2:96290404-96290426 AGGAAGTTGTTGATTGAGGAGGG + Exonic
935875612 2:107503779-107503801 ATAATGCAGCTGACTGAAGAGGG - Intergenic
938601929 2:132851290-132851312 ATGAGGTAGTAGATGGAAGTGGG + Intronic
938637504 2:133245227-133245249 TTGATGTAGTTGATCGTTGATGG - Intronic
938956798 2:136306471-136306493 AAGATGTAGTGAATGGAAGAAGG - Intergenic
939110471 2:138000637-138000659 AAGATGCTGTTGATTGTAGAAGG - Intronic
939421169 2:141971357-141971379 ATGATGTCTTTTATTGAGGAGGG - Intronic
941464001 2:165803518-165803540 ATGATGTAGTTTATAGAGCATGG - Intergenic
941799080 2:169634788-169634810 ATGATGGAGTTGAATTAACATGG - Intronic
941819697 2:169832025-169832047 AGGATGTTCTTGATTGGAGATGG + Intronic
943012657 2:182469699-182469721 ATGATGAAGTTTAGTGAAGAAGG - Intronic
943830698 2:192458134-192458156 AAGATGAGGATGATTGAAGATGG + Intergenic
943932463 2:193871471-193871493 ATGATCAAGTTAATAGAAGATGG + Intergenic
943986586 2:194629135-194629157 ATGATGTTGTGAATTAAAGAGGG - Intergenic
944438803 2:199720823-199720845 ATAATGTAGTGGATTGAATGGGG - Intergenic
944878539 2:203987351-203987373 ATGATGAAGATAATTGAAAAAGG - Intergenic
945740773 2:213658299-213658321 ATGAGGAAGTTGATAGCAGAAGG - Intronic
946098717 2:217300481-217300503 ATGATAAAGTTGGGTGAAGATGG + Intronic
947102339 2:226634671-226634693 ATGATATAGTTGAGTGAACTTGG - Intergenic
947364381 2:229379064-229379086 ATGATAGAGTTGAGTGAACACGG + Intronic
947448250 2:230181223-230181245 ATGAGGTAGTGAATTGAGGAAGG + Intronic
947648101 2:231759677-231759699 AAGAGGGAGTTGATGGAAGATGG - Intronic
948742911 2:240059897-240059919 AAGATGGAGTTGATTTAAAATGG + Intergenic
1169281089 20:4267472-4267494 AGGTTGAAGTGGATTGAAGAAGG + Intergenic
1170249516 20:14264731-14264753 AGGATCTAGTTGAAGGAAGAAGG + Intronic
1171773758 20:29347294-29347316 TTGATGAAGATGAGTGAAGATGG - Intergenic
1171815770 20:29784843-29784865 TTGATGAAGATGAGTGAAGACGG - Intergenic
1171902596 20:30871194-30871216 TTGATGAAGATGAGTGAAGATGG + Intergenic
1171949795 20:31410984-31411006 ATGATGGAGTTCTTTAAAGAAGG - Intronic
1173340801 20:42151101-42151123 TTGATGTTTTTGACTGAAGATGG - Intronic
1173766458 20:45614692-45614714 ATTATGAAGTTGTTTGAAGTGGG + Exonic
1174749057 20:53093898-53093920 ATCATGAAGTAGTTTGAAGACGG - Intronic
1174896548 20:54455454-54455476 ATGATGTATTTTAATGAACAGGG - Intergenic
1175736762 20:61392478-61392500 ATGATATAGTCCATTGAAGTAGG + Intronic
1177508545 21:22051255-22051277 TTTTTGAAGTTGATTGAAGATGG + Intergenic
1177769637 21:25500129-25500151 ATGCCGTAGTGGATTAAAGATGG + Intergenic
1180319221 22:11305410-11305432 TTGATGAAGATGAGTGAAGACGG - Intergenic
1180335986 22:11577162-11577184 TTGATGAAGATGAGTGAAGATGG + Intergenic
1182661853 22:31930709-31930731 ATGATGTCGCAGATTAAAGATGG - Intergenic
1184899757 22:47438080-47438102 ATGATATGGTAGATTAAAGATGG - Intergenic
949379901 3:3432894-3432916 ATGATGTTGTTTATTCAATAAGG - Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
955144305 3:56300814-56300836 ATGATGTCGTGGTTTGAACAGGG - Intronic
955178257 3:56638990-56639012 AAGAAGTAGTTGATATAAGAAGG - Intronic
955900313 3:63746857-63746879 TAGATGTGGTTGATTAAAGATGG + Intergenic
959108989 3:102098962-102098984 AAGGTGTGGTTGATTGCAGAAGG + Intergenic
959799585 3:110476198-110476220 ATGAGGTAGTTTTTTGAAGCAGG - Intergenic
960717574 3:120592648-120592670 ATGATGTGGTGAAGTGAAGAAGG - Intergenic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
965096639 3:164236993-164237015 ATGATGTATTTGGTTTATGATGG - Intergenic
971145530 4:23971961-23971983 ATTATGTATTTGATTAAAAATGG - Intergenic
971662898 4:29443002-29443024 ATGAGGTACTTGAAAGAAGAGGG + Intergenic
975399608 4:73919501-73919523 ATGATTCAGGTGACTGAAGATGG - Intergenic
975519440 4:75283832-75283854 ATGATGTTGATGGATGAAGATGG + Intergenic
976383927 4:84433778-84433800 ATGATGTAATTAATTATAGATGG + Intergenic
976933290 4:90595883-90595905 ATGTTGTAATTGATTTAATATGG + Intronic
978971559 4:114813627-114813649 ATGCTGGTGTTGACTGAAGATGG + Intergenic
979564434 4:122138273-122138295 ATGATTTGGTTGTGTGAAGAGGG - Intergenic
979759483 4:124383399-124383421 ATGATTAAGTTTAGTGAAGAAGG - Intergenic
980594765 4:134939386-134939408 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
981495068 4:145381731-145381753 ATAATGTAGTTGAATAAAGTAGG - Intergenic
981582012 4:146259130-146259152 GTGATGGAGTTGCTTTAAGAAGG + Intronic
981743219 4:148024965-148024987 ATGAGGTAGATGACTAAAGAAGG + Intronic
983077054 4:163338733-163338755 AGCATGTAGTTGATAGCAGAGGG - Intronic
984531173 4:180918048-180918070 TTGATGTTATTGGTTGAAGATGG - Intergenic
985379507 4:189377451-189377473 AACATGTAGTGGATTGAAGAGGG - Intergenic
988714661 5:33813419-33813441 TTGCTGTGGTTGATTAAAGATGG + Intronic
990207493 5:53444811-53444833 ATAATTCAGTTTATTGAAGATGG + Intergenic
990950279 5:61291809-61291831 ATGACTTAGTTAATAGAAGATGG - Intergenic
991158575 5:63467796-63467818 AGGAAGTAGTTTATTAAAGATGG + Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993663795 5:90670423-90670445 ATGGTGTAGTTGATCGGTGAGGG + Intronic
993873932 5:93284400-93284422 CTGTTGTAGTGGATCGAAGATGG - Intergenic
994779456 5:104070789-104070811 ATGATGAAGTTGATTTAATCAGG - Intergenic
997771488 5:136558560-136558582 AAGATGTTGTTGACTGAAAAGGG - Intergenic
998413381 5:141928098-141928120 CTGATGGAGTTGATTGGTGAAGG + Intronic
1000446226 5:161325093-161325115 ATGATGAAAATGATTGAAGAAGG - Intronic
1000875297 5:166630079-166630101 ATGATGGAGTTCATTGCATAAGG + Intergenic
1002663677 5:180807624-180807646 TTGAGGTAGCTGATTAAAGAGGG - Intronic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1005898477 6:30197536-30197558 ATTATGTACTTGATTAGAGATGG - Intronic
1007376643 6:41461437-41461459 CTGATGTCCTTGCTTGAAGAAGG - Intergenic
1008294818 6:49762420-49762442 CTCATGTAGTTTATTGAATACGG + Intergenic
1008316981 6:50055900-50055922 ATGATGAAATTAATTAAAGATGG + Intergenic
1008448849 6:51625671-51625693 ATAATGTAGTTAATTTAAGCGGG + Intronic
1008769307 6:54960015-54960037 CTAATTTAGTTGATTGAACAAGG + Intergenic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1011587889 6:88946517-88946539 ATGATTAAGTTCAGTGAAGAAGG + Intronic
1012116414 6:95304034-95304056 TTGAAGGAGTTGATAGAAGATGG - Intergenic
1012942723 6:105432825-105432847 ATAATGTTGATGATTGATGATGG - Intergenic
1013946880 6:115732085-115732107 ATGAGGTAATTAATTGTAGATGG - Intergenic
1018699718 6:166416727-166416749 ATGATGGAGGTGATTGTGGAGGG - Intronic
1021297638 7:18928165-18928187 ATGCTGTAGTAGGTTGAACAGGG - Intronic
1024801450 7:53085135-53085157 ATGGTTTAGTTGAATGAAAATGG + Intergenic
1027502336 7:78968771-78968793 ATGATGTAGTTTATTGAGACAGG + Intronic
1027525965 7:79269021-79269043 ATGGTGGAGTTGATGAAAGAGGG + Intronic
1028296643 7:89140913-89140935 ATGATTAAGCTCATTGAAGAAGG - Intronic
1030697993 7:112607329-112607351 ATAATGTAGCTGATTATAGAAGG + Intergenic
1030992982 7:116323691-116323713 ATGATGAAGCTTAGTGAAGAAGG + Intronic
1031552846 7:123136213-123136235 AAAATGTATTTGACTGAAGATGG + Intronic
1032814644 7:135460344-135460366 ATGATTAAGTTCAGTGAAGAAGG - Intronic
1034727521 7:153351957-153351979 ATGATTAAGTTTAATGAAGAAGG + Intergenic
1039088259 8:33801121-33801143 CCGATGATGTTGATTGAAGATGG - Intergenic
1040886573 8:52269775-52269797 ATGAGGAAGTTGATAGAAGTTGG + Intronic
1042456964 8:69016336-69016358 ATGTTGTAGTTGATTTAACTAGG + Intergenic
1045054553 8:98358000-98358022 ATGTTGGAGTTTATTGAAGGGGG - Intergenic
1045602540 8:103733803-103733825 GTGGTGTAGGTGATTTAAGATGG + Intronic
1046542896 8:115609603-115609625 ATTTTGTAGTTTCTTGAAGAAGG - Intronic
1047164102 8:122417541-122417563 ATGATGTATCTAATTGAAGAGGG + Intergenic
1048520633 8:135151014-135151036 ATGATGTTGTTACTTGATGAGGG + Intergenic
1050718142 9:8553520-8553542 ATAGTGTAGTTGATTGCATAGGG - Intronic
1051617473 9:19019887-19019909 ATGCTGTAGTTTACAGAAGAGGG - Intronic
1059857818 9:118420168-118420190 ATGATGTAGGATATTGTAGAGGG - Intergenic
1060254447 9:122014805-122014827 ATGATGTAGTGGAAAGATGACGG + Intronic
1060868868 9:127023087-127023109 ATGATGATGGTGTTTGAAGAAGG - Intronic
1203367448 Un_KI270442v1:271159-271181 TTGATGAAGATGAGTGAAGACGG - Intergenic
1185523984 X:762571-762593 ATGATGTTATGGGTTGAAGAGGG - Intergenic
1189060140 X:37744981-37745003 ATGATTAAGTTTAGTGAAGAAGG - Intronic
1189177024 X:38967797-38967819 ATGATCTTGTAGATTAAAGATGG - Intergenic
1189257506 X:39651986-39652008 ACGAGGAAGTTGGTTGAAGAGGG - Intergenic
1189432874 X:40964605-40964627 TTAATGTAGTGGATTAAAGATGG - Intergenic
1190944513 X:55078244-55078266 ATCATGTAGTTGCTTTAAGTAGG - Intronic
1190945756 X:55092177-55092199 ATCATGTAGTTGCTTTAAGTAGG - Intronic
1190964308 X:55283568-55283590 ATTATGTAGTTGCTTTAAGTAGG - Intronic
1192694224 X:73398064-73398086 ATGATGTCAGTGATTGGAGAGGG - Intergenic
1197170081 X:123423244-123423266 ATGAAGTACTTTGTTGAAGAGGG + Intronic
1197266867 X:124383755-124383777 ATGATGTTGTTGCTGGCAGATGG - Exonic