ID: 928912056

View in Genome Browser
Species Human (GRCh38)
Location 2:36431885-36431907
Sequence TTGCTGTCATTGTTGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928912055_928912056 30 Left 928912055 2:36431832-36431854 CCTTCACTCTGACATATTTAAAA 0: 1
1: 0
2: 3
3: 22
4: 448
Right 928912056 2:36431885-36431907 TTGCTGTCATTGTTGCACAAAGG 0: 1
1: 0
2: 0
3: 13
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928912056 Original CRISPR TTGCTGTCATTGTTGCACAA AGG Intronic
900831951 1:4971809-4971831 TTGCTGTCACTGTGGGACCATGG - Intergenic
903269861 1:22180979-22181001 GTGCTGTGATGGTTGCACAATGG + Intergenic
905695314 1:39969319-39969341 TTACTGTCCTTGCTGCACACAGG - Intronic
905868902 1:41391790-41391812 TCGCTGTCACTGTTGAATAAAGG + Intergenic
906792609 1:48671997-48672019 TTGTTGTCCTTGTTGCAAAAGGG - Intronic
907740279 1:57158796-57158818 TTGCTGTCATTATTGCTAAAAGG + Intronic
908783534 1:67713291-67713313 TTGCTTTCATTTTTGCATATGGG + Intronic
909277974 1:73713010-73713032 TTGATGTAATTTTTGCAAAAGGG + Intergenic
913460129 1:119076597-119076619 TTGCTGTCTTTCTGGAACAAAGG + Exonic
918880038 1:190107042-190107064 TTGCTTTAATTGTGACACAAAGG - Intronic
920541053 1:206778226-206778248 TTGGTGCCATAGTTGCACAAAGG - Intergenic
922988928 1:229888460-229888482 TTACTGTCATCGTTTCAGAAAGG + Intergenic
924840377 1:247704328-247704350 GTGCTGTATTTGTTGTACAAAGG + Intergenic
1063601717 10:7487827-7487849 GTCATGTCCTTGTTGCACAATGG + Intergenic
1064884138 10:20090999-20091021 TTGCTATCTATGTTGCACACAGG + Intronic
1070019747 10:72572814-72572836 TTGTTGACAATGTTGCAGAATGG + Intronic
1070273258 10:74978966-74978988 TTGCTGTGAATCTTACACAAAGG + Intronic
1071212756 10:83363125-83363147 TTGCTTTTATGGTTACACAATGG - Intergenic
1071864011 10:89705276-89705298 TTGCTGTTATTCTTGCAGAATGG + Exonic
1077447624 11:2606248-2606270 TCGTTGTAATTGTTTCACAATGG + Intronic
1079591418 11:22187801-22187823 TTGCTGCCATTGTTTGCCAAAGG + Intergenic
1080287393 11:30631180-30631202 TTAGTGTCATTGTTGCTCATGGG + Intergenic
1081251772 11:40844773-40844795 TTTCTTTCATTGTTGTAAAATGG - Intronic
1081443423 11:43105637-43105659 TGGCTGTCTTTGTATCACAATGG - Intergenic
1086329380 11:85738346-85738368 TTCCTTTCATTGTTCCAGAAAGG + Intronic
1086452380 11:86929835-86929857 TTTCTGTCATTGATGCCCAGAGG - Intronic
1088440040 11:109860126-109860148 TTGCTGTCATTGCAGGAGAATGG - Intergenic
1088985081 11:114898842-114898864 TTGCTTTCATTGCAGCACTAAGG - Intergenic
1089794795 11:120971647-120971669 TTGCTGTAATGGTTGCAGTATGG + Intronic
1090786519 11:130053501-130053523 TTGCTTTCATTGTTGCATATTGG - Intergenic
1093982926 12:25494974-25494996 TTGCAGCAATTGTTGCTCAAAGG - Intronic
1096351118 12:50902225-50902247 TTGCTGACTTTGTTCCACTATGG - Intergenic
1104771788 12:131368499-131368521 TTGCTGTCCATGCTGCACACAGG - Intergenic
1106096991 13:26655609-26655631 TTGCTGTGGTGGTTGCAGAATGG + Intronic
1106658539 13:31773946-31773968 TTGCTGTCTTCATTGTACAATGG - Intronic
1108456204 13:50616355-50616377 TTGCTGTGCTTGTTGCAAAGAGG - Intronic
1109417798 13:62066285-62066307 TTGCTGTCATTTGTGCACATGGG - Intergenic
1109502088 13:63250946-63250968 TTGTTGTCCTTCTTGCTCAATGG - Intergenic
1109721276 13:66278832-66278854 TTGAACTCCTTGTTGCACAATGG - Intergenic
1110742037 13:79008731-79008753 TTTATGTCACTGTTGCAGAAAGG - Intergenic
1113170604 13:107498417-107498439 TTCCTGTCATTGTTAAAAAATGG + Intronic
1114997786 14:28378872-28378894 TTGATTTCTTTGTTGCACAGAGG - Intergenic
1116428655 14:44820675-44820697 TTGCTGACATTCTTGCAGAGAGG - Intergenic
1117180024 14:53182093-53182115 TTACTGTCATACTTTCACAATGG - Intergenic
1122057292 14:99110659-99110681 ATGCTCTCAGTGTTGAACAAGGG + Intergenic
1122395392 14:101425060-101425082 TTTCTGTCACTGTTTAACAAAGG + Intergenic
1124706876 15:31973932-31973954 TTGCCGTCTTTGTTTCACAGAGG + Intergenic
1125306256 15:38319278-38319300 TTGTTGTTGTTGTTGCAAAATGG + Intronic
1125521356 15:40349435-40349457 TTGCTAACATTGTTGGTCAAAGG - Intergenic
1127061015 15:55184519-55184541 TTGTTGTGATTGTTGCCAAATGG - Intronic
1131440686 15:92457284-92457306 TGGCTGTCACTGTTGGAAAAGGG - Intronic
1132467598 16:84660-84682 TTGCTGTCTCTGTTTCTCAAGGG + Intronic
1134410838 16:14002070-14002092 GTGCTGTCATGGTTGCTAAAAGG + Intergenic
1134699857 16:16256137-16256159 TGGCTGACATTGTTGCAACAGGG + Exonic
1134971968 16:18538525-18538547 TGGCTGACATTGTTGCAACAGGG - Exonic
1138921067 16:61529828-61529850 TTGTTGCCTTTGTTTCACAATGG - Intergenic
1141336069 16:83156553-83156575 TTGTTGTGGTTGTTGCACAAAGG + Intronic
1145810865 17:27763357-27763379 ATACTGTCCTTGTTTCACAAAGG - Intronic
1145883432 17:28367646-28367668 TTGCTGTCCCTGGTGCACAAGGG - Intronic
1146193392 17:30790550-30790572 TTGCTGTTAATGATTCACAAAGG + Intronic
1146983870 17:37193754-37193776 TTGCAGTGACTGTGGCACAAGGG - Intronic
1148271657 17:46266613-46266635 TAGCTGTCATTTTTGCAGACAGG - Intergenic
1149014573 17:51892807-51892829 ATGCAGTCATTTTAGCACAATGG + Intronic
1149367387 17:55959458-55959480 TGGCTTTCATTGTTACATAATGG + Intergenic
1149414597 17:56446381-56446403 TTGCTGTCATAGATTCCCAAAGG - Intronic
1150365824 17:64583255-64583277 ATGCTGTCATTGTAGCTCCAGGG - Intronic
1150765119 17:67996189-67996211 TAGCTGTCATTTTTGCAGACAGG + Intergenic
1152962557 18:88543-88565 TTCCAGTAACTGTTGCACAAAGG - Intergenic
1153787919 18:8551335-8551357 TTACTGTCATAATTTCACAAAGG + Intergenic
1155154018 18:23143591-23143613 ATTCTGTCCTTGTAGCACAAAGG - Intronic
1157688502 18:49662159-49662181 TTACTGTCATGCTTGCATAAAGG - Intergenic
1158063405 18:53375859-53375881 TTGCTGTAATTGGTGACCAAAGG + Intronic
1158770261 18:60507626-60507648 TTGCTGTCATTCTTCCAGATGGG - Intergenic
1159255277 18:65937118-65937140 TTGCTGCCTTGGCTGCACAAAGG + Intergenic
1159603922 18:70455264-70455286 TTGCTGTTATTGTTACTTAATGG + Intergenic
1159683405 18:71384756-71384778 TTGCTTCCTTTGTAGCACAAAGG - Intergenic
1159766632 18:72498970-72498992 TTGCTGTCATGGTTGAATCATGG - Intergenic
1159768988 18:72526708-72526730 TAGCTCTCATAGGTGCACAAAGG - Intergenic
1160116947 18:76087665-76087687 TTGCTGTGATGGTTGCCAAATGG - Intergenic
1160472436 18:79148674-79148696 TTGCTGTTACTGTTACTCAATGG + Intronic
1160618183 18:80149837-80149859 TTGCTGTCATTGTTGAAATTAGG + Intronic
1162857248 19:13478325-13478347 TTGCTGTCATTTTTACAGACAGG + Intronic
925543851 2:4996362-4996384 TTGTTGTGATTGTTGTTCAAAGG - Intergenic
928912056 2:36431885-36431907 TTGCTGTCATTGTTGCACAAAGG + Intronic
930981669 2:57533092-57533114 TTGCTGTCATTGTTGATTATTGG - Intergenic
932628811 2:73320880-73320902 TTGCTGTTAGTGTCCCACAAGGG + Intergenic
934533389 2:95111993-95112015 TTTCTGTCATTTTTCCAGAAGGG + Intronic
934655025 2:96112849-96112871 GTGGTGTCCTTGTTGCCCAAAGG - Intergenic
936963097 2:118097598-118097620 TTGCTGCCATACTTCCACAATGG + Intronic
940225531 2:151397349-151397371 CTAATGTCATTGTTGCAAAATGG + Intergenic
941536852 2:166733812-166733834 TTGGTAGCATTGTTTCACAATGG - Intergenic
941653254 2:168116281-168116303 TTGCTGTGAAAGTTGTACAAGGG + Intronic
941655627 2:168141557-168141579 TTGCTTTCATTTTTACACAGTGG + Intronic
942685557 2:178527307-178527329 TTTTTGTCATTGTTCCATAAAGG - Exonic
943141251 2:183984734-183984756 TTGCTCTCTTTGAAGCACAATGG + Intergenic
943819355 2:192300301-192300323 TTGTTGTTATTGTTGCTTAATGG + Intergenic
944329814 2:198452337-198452359 TTGCTCTCATTGTTGCTTCATGG + Intronic
944567769 2:201008207-201008229 TTGCTTTCTTGGTTGCAGAATGG - Intronic
944911955 2:204319091-204319113 TTGCTGTCATATTGGCCCAAAGG + Intergenic
946373334 2:219293922-219293944 TTGGTGTCAGTGTTGGAAAAGGG + Intronic
948228241 2:236329735-236329757 TTGCTGTAATGGAGGCACAAAGG + Intronic
1169109791 20:3024961-3024983 GTGCTGTCTTTGTAACACAAAGG + Intronic
1169723364 20:8702747-8702769 TTGCTGTAATTGGTGGACATTGG - Intronic
1170870219 20:20199254-20199276 TTGTTGTTGTTGTTGAACAAAGG + Intronic
1174327998 20:49794867-49794889 TTTATGTCATTCTTGCACAGGGG - Intergenic
1175376246 20:58526147-58526169 TTGATGTGATGGTTGCACACTGG - Intergenic
1176895061 21:14367408-14367430 TAGTTATCATTGTTGCCCAAAGG + Intergenic
1180613722 22:17114094-17114116 TTGTTGCCATTTTTCCACAATGG - Exonic
1182828120 22:33283220-33283242 TTGCTGTCAATGCTGGACATGGG - Exonic
949374490 3:3372934-3372956 ATGCTGTCATAAGTGCACAAAGG - Intergenic
950417673 3:12877503-12877525 TTGCTTTTCTTGTTGCAGAAGGG - Intergenic
951813934 3:26731908-26731930 TTTCTGGAATTGTTTCACAATGG - Intergenic
954746992 3:52793004-52793026 TGGCTGGCACTGTTGCCCAATGG - Intergenic
955109429 3:55933296-55933318 TTGGTTTCATTTTTGCACAGAGG - Intronic
955556417 3:60142500-60142522 TTGTTGTTATTGTTTTACAAAGG + Intronic
958256995 3:91336473-91336495 TTGCTGCCATTGTTGCCAATTGG + Intergenic
961220764 3:125197819-125197841 TTGCTGTGATGGCTGCAAAATGG - Intronic
967405371 3:189109874-189109896 TTTCTGACATTCTTGCAAAAGGG - Intronic
967606318 3:191451471-191451493 TTGCTGTGAGTCTTGCAAAAAGG + Intergenic
967710940 3:192707442-192707464 TTGTTCTCATTCTTGAACAATGG - Intronic
971137663 4:23887502-23887524 TAGCTGTCATAGTTGCAAAGAGG - Intronic
972074878 4:35074859-35074881 TAGCTTTCATTTTTGCAGAATGG + Intergenic
974631681 4:64498940-64498962 TTGCTATGATTTTTGCATAATGG + Intergenic
974713661 4:65637313-65637335 TTGCTGTCATTGTCACAGATTGG + Intronic
976108748 4:81647513-81647535 TTTCTTTCATTGTTACAAAATGG - Intronic
976774425 4:88691934-88691956 TTGCTGGCATTGCTGCCCCAGGG + Intronic
976945384 4:90759554-90759576 ATGTTGTTATTGTTGCACCATGG + Intronic
977961111 4:103086784-103086806 TTGCTGACATTCTTGTACCATGG - Intronic
978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG + Intergenic
979366873 4:119836007-119836029 TGGCTGTCATGATTGCATAAAGG + Intergenic
979776535 4:124595588-124595610 TTGCTGAGATTATTGCAAAATGG + Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
981335150 4:143561091-143561113 TTGCTGCCATTGTTTGCCAAAGG + Intergenic
983490802 4:168386773-168386795 CTGCTGTCATTGTTTCGCATGGG - Intronic
986722324 5:10568415-10568437 TTGTTTTAATTGTTGCAGAAGGG + Intronic
989633698 5:43512453-43512475 TTACTGACATTGTTTCGCAATGG + Intronic
991733447 5:69610605-69610627 TTATTGTCATTGTTGGACCATGG + Intergenic
991809882 5:70465751-70465773 TTATTGTCATTGTTGGACCATGG + Intergenic
991861506 5:71017245-71017267 TTATTGTCATTGTTGGACCATGG - Intronic
992457381 5:76928158-76928180 TCACTGTCATTTTTACACAATGG + Intergenic
994067021 5:95554902-95554924 TTTCTGTCGGTTTTGCACAAGGG - Intronic
994265767 5:97714676-97714698 TTTGTGTCATTCTGGCACAAAGG + Intergenic
997331116 5:133062624-133062646 TTGGTGGCATAGTTGCAGAAAGG + Intronic
1001021255 5:168184255-168184277 TTGCAGTCATGGTTTCACAGAGG - Intronic
1010562396 6:77366887-77366909 CTGCTTTCATTGTTGCACTATGG - Intergenic
1013535179 6:111057286-111057308 TTCCTGTCATTTTGGCTCAAGGG + Intergenic
1015658618 6:135547688-135547710 TTGATGTTATTGTGGCCCAAGGG + Intergenic
1016832020 6:148443623-148443645 TTACTGTGATGGTTGCAGAAGGG + Intronic
1018596199 6:165483376-165483398 TTCTTATCATTGTTGCATAATGG + Intronic
1022052389 7:26690015-26690037 TAGCTTTCATTTCTGCACAAAGG - Intronic
1022397421 7:30001809-30001831 TTGCTGTCAGGGTAACACAAAGG + Intergenic
1022711516 7:32855118-32855140 ACGCTGCCATTGTTGCAGAAAGG - Intergenic
1022913141 7:34919841-34919863 ACGCTGCCATTGTTGCAGAAAGG + Intergenic
1024177079 7:46851549-46851571 ATGCTGGCAATGTTGGACAAGGG + Intergenic
1028220960 7:88195926-88195948 TTTCTGTCGTGGCTGCACAAGGG + Intronic
1028391261 7:90320610-90320632 TGGCTGTCAATGTTGTAAAAGGG - Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030189212 7:106794074-106794096 TTGTTCTCATTTTTGCATAAAGG + Intergenic
1030962315 7:115941145-115941167 TTGGTCTCATTGTTCTACAAAGG + Intronic
1031841715 7:126749881-126749903 TTGCTGTTAGTGATGCAAAATGG + Intronic
1033791529 7:144796922-144796944 TTGCTGAGATTGTTGCAGAGAGG - Intronic
1033918404 7:146356987-146357009 ATGCTGTCGTTTTTGCAGAAAGG - Intronic
1034856932 7:154558734-154558756 TTTCTGTGATGTTTGCACAATGG + Intronic
1036721870 8:11183316-11183338 TTCCTATCATCATTGCACAAGGG + Intronic
1036941204 8:13054270-13054292 TTGCTATCAATAGTGCACAAGGG - Intergenic
1037097925 8:15008298-15008320 TTTCTGTCATGGTTTAACAATGG + Intronic
1037399087 8:18475583-18475605 TTGCTTGCATTGTTGAAGAAGGG - Intergenic
1038946253 8:32363577-32363599 TTGCTAACCTTGTTCCACAAAGG - Intronic
1039836999 8:41264584-41264606 TTGCTGTCACTATTACATAATGG + Exonic
1042167854 8:65963617-65963639 TTGTTATTATTCTTGCACAAAGG + Intergenic
1043455165 8:80405562-80405584 TACATGTCATTCTTGCACAAGGG - Intergenic
1044171294 8:89055579-89055601 TTGCTGACATTTTGGCACACAGG - Intergenic
1044816931 8:96123094-96123116 TTCCTGTCAATATTGCAGAAGGG + Intergenic
1045218014 8:100168157-100168179 TTGCTGTCAGGATTGCACAATGG - Intronic
1045342185 8:101264872-101264894 TTGCTGTTGTTGTTGGACACTGG - Intergenic
1045882205 8:107054451-107054473 TTGTAGTGATGGTTGCACAATGG + Intergenic
1045998934 8:108396431-108396453 TTTCTGTCATGGTTGCAAAATGG + Intronic
1046188234 8:110751538-110751560 TTGCTGTAATTGTAGAACATTGG - Intergenic
1046615246 8:116470136-116470158 TTCCAGTCATTGTTACAAAAAGG - Intergenic
1048358117 8:133670263-133670285 TAGTTGTCATAGTTGCACCATGG - Intergenic
1049567729 8:143350231-143350253 TGCCTGTCATTCTTGCACAGCGG - Intronic
1050028347 9:1359103-1359125 TTGCTCTAATTATTGCACGACGG + Intergenic
1050849521 9:10265602-10265624 ACTCTGTCATTGTAGCACAAAGG + Intronic
1052433674 9:28398982-28399004 TTTCTGTCTTTGTAGGACAAAGG + Intronic
1052706845 9:32004373-32004395 TTTCTGTCATTGTCACCCAAGGG - Intergenic
1055755790 9:79555914-79555936 TTTATGTCATTGTGACACAATGG + Intergenic
1056435779 9:86574958-86574980 TGGCTGTCATTGTTCCCCAAAGG + Intergenic
1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG + Intergenic
1062315529 9:135965276-135965298 ATGCTGTCCTTTTTGGACAAGGG + Intergenic
1062735583 9:138135574-138135596 TTCCAGTAACTGTTGCACAAAGG + Intergenic
1187386874 X:18857151-18857173 TTGTTGTCATTTTTAAACAAGGG + Intergenic
1188651786 X:32639763-32639785 TTGCAGTTATTTTTTCACAATGG - Intronic
1190052906 X:47164651-47164673 TTCCTACCAGTGTTGCACAAGGG - Intronic
1194024305 X:88732984-88733006 TTGCTGTTTTTATTCCACAATGG + Intergenic
1195070698 X:101276670-101276692 TTGCTGTCCTTGTTTTATAAAGG - Intronic
1198692053 X:139295120-139295142 TTGCTGTCATTTCAGCACCAAGG + Intergenic
1201075685 Y:10185485-10185507 CTGCTGGCATAGTTTCACAATGG + Intergenic