ID: 928912705

View in Genome Browser
Species Human (GRCh38)
Location 2:36439083-36439105
Sequence CAGGGGAAACATTCATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928912705_928912707 -10 Left 928912705 2:36439083-36439105 CCTGCAAATGAATGTTTCCCCTG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 928912707 2:36439096-36439118 GTTTCCCCTGAGTGAGGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 163
928912705_928912711 3 Left 928912705 2:36439083-36439105 CCTGCAAATGAATGTTTCCCCTG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 928912711 2:36439109-36439131 GAGGCACAGGTGCCATGAAGTGG 0: 1
1: 0
2: 2
3: 25
4: 212
928912705_928912713 19 Left 928912705 2:36439083-36439105 CCTGCAAATGAATGTTTCCCCTG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 928912713 2:36439125-36439147 GAAGTGGTATTCTATCCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928912705 Original CRISPR CAGGGGAAACATTCATTTGC AGG (reversed) Intronic
904317807 1:29677149-29677171 CCGGGGAAACCCTCATTCGCAGG - Intergenic
906716009 1:47969828-47969850 CAGGGGAAACATCACCTTGCTGG - Intronic
907362502 1:53930103-53930125 CTGGGGAAACATTCCTGTGGTGG + Exonic
907919120 1:58896555-58896577 CAGGAGAAATATCCTTTTGCAGG + Intergenic
912229810 1:107779585-107779607 CAGCAGAAACATAAATTTGCAGG + Intronic
912811623 1:112799397-112799419 CAGGGGAAACAGGCATCAGCTGG - Intergenic
914774285 1:150721682-150721704 CAGTGTAAACATTCAATTACAGG + Intergenic
915135809 1:153730651-153730673 GAGGGGAAGCATGCATTTTCTGG + Intronic
918112280 1:181467405-181467427 AGGGGGAAACATTGTTTTGCAGG + Intronic
919245908 1:194983431-194983453 CTGGGGATACATTCATTTGTTGG - Intergenic
919876656 1:201874260-201874282 CTGGACAAACATTCCTTTGCTGG + Exonic
922056259 1:222045169-222045191 CAGAGGAAACATACCTTTTCTGG + Intergenic
924698090 1:246420809-246420831 CAGGGCAAAAAATCATTAGCTGG + Intronic
1064504660 10:16015617-16015639 CTGGGGAAGCATTCATTTGAAGG - Intergenic
1067535450 10:47106533-47106555 ATGGGGATACATTCATTTGTTGG - Intergenic
1068275954 10:54797015-54797037 CAGGGAGAGCATTCATTAGCTGG + Intronic
1071167971 10:82828947-82828969 CAGGGCAAATTTTCATCTGCAGG - Intronic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1078186925 11:9060101-9060123 TAAAGGAAGCATTCATTTGCAGG - Intronic
1078835769 11:15027786-15027808 CAGTAGAAAAATTCATTTCCTGG + Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1083147917 11:60772661-60772683 AAGGGGAAACATTCATGGGTGGG - Intronic
1087527104 11:99329405-99329427 CAGAGGAAATATTTATTTTCTGG + Intronic
1090086234 11:123653772-123653794 CAGGGGAAACAATCTATTGAAGG + Exonic
1097065719 12:56319113-56319135 CAGGGAAATCATTCGTTTTCGGG + Exonic
1099067988 12:78007424-78007446 CAGTGGCACCATTCATTTACAGG + Exonic
1099865823 12:88279441-88279463 CAGGGGATCCATTCATTTGTTGG - Intergenic
1100351955 12:93792876-93792898 CAGGGGAAACTTTAATTTTATGG - Intronic
1104468179 12:129006787-129006809 ATGGAGAAACATGCATTTGCTGG - Intergenic
1108459964 13:50655696-50655718 CACAGGAAACATTCATTAGTTGG - Intronic
1108587943 13:51887559-51887581 CAGCAGAAACATTCATTGTCTGG - Intergenic
1109946891 13:69446039-69446061 CAGGGGCTACATTCATCTGAAGG - Intergenic
1110789060 13:79567417-79567439 CAGGGGAGTCATTTATTTGATGG + Intergenic
1114234357 14:20811766-20811788 AGGGGGAAACATCCAATTGCAGG + Intergenic
1114939224 14:27586299-27586321 GAGGTTAAACATTCATTTGCTGG + Intergenic
1116093975 14:40344169-40344191 CTGGAGAAAGATTCACTTGCTGG - Intergenic
1120385180 14:83836323-83836345 CAAGGGAAATTTTCATTTGAAGG + Intergenic
1120465493 14:84851825-84851847 CTGGGGAAACATTCTTTTTGAGG - Intergenic
1121975301 14:98397876-98397898 CAGGGGAAACCCTTGTTTGCTGG - Intergenic
1122526900 14:102392983-102393005 CTAGGGAAAAATTGATTTGCTGG - Intronic
1123571627 15:21616899-21616921 AAGGGGAGAGATTCATTTCCTGG + Intergenic
1123608243 15:22059490-22059512 AAGGGGAGAGATTCATTTCCTGG + Intergenic
1127718029 15:61669790-61669812 CAGGGGAAATATACATTTTGAGG + Intergenic
1128064783 15:64757750-64757772 CAGGGGAAACATTCAGGAACAGG + Intronic
1130120261 15:81041846-81041868 CAAGGGACACAGTCACTTGCAGG + Intronic
1131600023 15:93837753-93837775 CAGGGGAAGCATTCTTTCCCAGG - Intergenic
1202980480 15_KI270727v1_random:351288-351310 AAGGGGAGAGATTCATTTCCTGG + Intergenic
1133179764 16:4044861-4044883 CTGGGGAAAGATTTATTTTCTGG - Intronic
1135989152 16:27206885-27206907 CTGGGGAAACACTCTCTTGCTGG - Intronic
1138561465 16:57803123-57803145 CTGGGAAGATATTCATTTGCTGG - Intronic
1138680970 16:58683448-58683470 CAGAGGAAACATTCCTCTGCTGG + Intronic
1141131536 16:81440966-81440988 CAGGGGGAACATCCACTTACAGG + Intergenic
1142211227 16:88809584-88809606 CAGGGAACACATTCCTTTGCTGG - Exonic
1144436282 17:15245630-15245652 CAGGGTAAACAAGCATTTACAGG + Intronic
1148543838 17:48501897-48501919 CAGGGGAAAGATCCATTCTCTGG + Intergenic
1149414309 17:56443065-56443087 CAGGGGAATCATTCATTATGTGG - Intronic
1153382189 18:4453563-4453585 CAGGGTAAAAAATAATTTGCAGG + Intronic
1153393680 18:4592434-4592456 AAGGGGAAGCATTGATTTGGGGG + Intergenic
1156245441 18:35293494-35293516 CAGGGGAAAGATTGATTACCAGG + Intergenic
1158290839 18:55940468-55940490 CAGAGGAAACATTCAATTCTGGG - Intergenic
1163705259 19:18808662-18808684 CAGGGGAAACTTTCCTTAGCTGG - Intergenic
1164557285 19:29263399-29263421 GAGGGGAAACCATCATTTGGTGG - Intergenic
1166191058 19:41176965-41176987 CTGGGAAAACATTCTTTTGCAGG - Intergenic
927108325 2:19846314-19846336 CCTGGGAAACAATCAGTTGCTGG - Intergenic
928912705 2:36439083-36439105 CAGGGGAAACATTCATTTGCAGG - Intronic
929438898 2:41949968-41949990 CAGAGGAAACTTTTCTTTGCAGG + Intronic
930432631 2:51299671-51299693 CAGGGGAAACATCCATTTCTTGG + Intergenic
933585279 2:84173479-84173501 CAGGGGATACACTTTTTTGCAGG - Intergenic
935155186 2:100478383-100478405 TAGGGGAAACATTTTTTTCCTGG - Intronic
936091274 2:109502919-109502941 CAGTGCAAACCTTCATCTGCTGG + Intronic
937370037 2:121290976-121290998 CAGGTGAACCTTCCATTTGCCGG + Intergenic
937998493 2:127713625-127713647 CGGGGGAAACGTTCATCTCCGGG + Exonic
938913108 2:135904322-135904344 CATGGGAAACATTTATTTCCGGG + Intergenic
939586875 2:144016634-144016656 TAGGGGAAGCCATCATTTGCAGG + Intronic
943755864 2:191556325-191556347 CAGGGGAAATATTTATTAGTGGG + Intergenic
945447851 2:209959486-209959508 CAGGGAAAACCTTCATTTACTGG + Exonic
945743222 2:213688775-213688797 CAGGAGAAAAATTAATTTGGAGG - Intronic
946997620 2:225412938-225412960 CATGGGAGACAGTCATTTGCGGG + Intronic
947226476 2:227845358-227845380 TAAGGGAAACATTCACTTGTAGG + Intergenic
947849644 2:233275344-233275366 CTGGGGAAACATTCAGTACCTGG + Intronic
1169876561 20:10303756-10303778 GATGGGAATCATTCATTTTCTGG + Intronic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1171041476 20:21767854-21767876 CAGGGCAAACACGCATTTGAGGG - Intergenic
1171149575 20:22815381-22815403 CGGGGCAAACAGTCCTTTGCTGG + Intergenic
1171332972 20:24357567-24357589 CAAGGAAGACATTTATTTGCAGG + Intergenic
1173978621 20:47206152-47206174 CAGGGGTTACATGCATTTGGAGG - Intergenic
1175292743 20:57888890-57888912 CAGTGACAACATTCATATGCTGG - Intergenic
1177829142 21:26117378-26117400 CAGGGGAATAATTCATCTGTAGG + Intronic
1178896329 21:36561631-36561653 CTGGGGCAACATTACTTTGCTGG - Intronic
1180823654 22:18848451-18848473 CAGGGGAAACTTGCATCTACAGG - Intronic
1181189085 22:21126095-21126117 CAGGGGAAACTTGCATCTACAGG + Exonic
1181210115 22:21284400-21284422 CAGGGGAAACTTGCATCTACAGG - Intergenic
1181399410 22:22642545-22642567 CAGGGGAAACTTGCATCTACGGG + Intergenic
1181650007 22:24253523-24253545 CAGGGGAAACTTGCATATACGGG - Intergenic
1181707368 22:24657223-24657245 CAGGGGAAACTTGCATCTACGGG + Intergenic
1182896246 22:33861707-33861729 CAGTGAAAGCATTTATTTGCGGG - Intronic
1183031591 22:35110537-35110559 CATGGCAAACGTTCAATTGCTGG + Intergenic
1184907942 22:47502793-47502815 CAGGGGAAAAATTGAATGGCTGG + Intergenic
1203216833 22_KI270731v1_random:11033-11055 CAGGGGAAACTTGCATCTACAGG + Intergenic
1203273796 22_KI270734v1_random:74357-74379 CAGGGGAAACTTGCATCTACAGG - Intergenic
951804317 3:26627708-26627730 AAGGAGAAGCATTCATTTTCCGG + Intronic
952115175 3:30170465-30170487 CATGGGAAAGATTCAATTGAGGG + Intergenic
952646512 3:35665570-35665592 TAGTGAAAACATTCATTTGGAGG + Intronic
955419672 3:58723989-58724011 GAGGACAAACATTCATTCGCTGG + Intronic
956658113 3:71572179-71572201 CAGGCAAAGCATTCATTTGAAGG - Intronic
957809944 3:85208476-85208498 CCTGGGAAAAATGCATTTGCAGG + Intronic
959312074 3:104751542-104751564 GAGTGGACACATTCATTAGCTGG - Intergenic
960053470 3:113259405-113259427 CAAGGGAAAGATTGATTTGCCGG + Intronic
966600025 3:181765781-181765803 GAGGGGAAAGACTTATTTGCTGG - Intergenic
967512970 3:190334549-190334571 AAGTGGAAAGATTCAGTTGCTGG - Intronic
970367122 4:15371270-15371292 CAGGGGAAGAATGCATTTGGTGG + Intronic
971089236 4:23320968-23320990 CAAGGGAGACATTCATATGATGG + Intergenic
971140521 4:23920541-23920563 CAGGGGTAAAAGGCATTTGCTGG - Intergenic
972077120 4:35102864-35102886 CAGGTGGAACATTGATTTGCTGG + Intergenic
972838121 4:42900044-42900066 CAAGGCAAACGTTCTTTTGCTGG + Intronic
975712070 4:77170879-77170901 AAAGGAAAACATTTATTTGCGGG - Intronic
976211352 4:82674664-82674686 TAGAGTAAACATTCATGTGCGGG - Intronic
976402306 4:84621262-84621284 CAGGAGAAAAATTCATTTATTGG - Intronic
977212427 4:94234749-94234771 TAGGGGAATCATTTAATTGCAGG + Intronic
980779191 4:137475142-137475164 CAGCAGAAACACACATTTGCAGG + Intergenic
981963798 4:150577040-150577062 CAAGGCAAACATTCAATTACTGG + Intronic
982811120 4:159827112-159827134 CTTGGGAAACATTCATTTACGGG + Intergenic
983542752 4:168930751-168930773 GAGGAGAAACTTTCCTTTGCTGG + Intronic
984947393 4:184980556-184980578 CAGCTAAAACATTCATGTGCAGG - Intergenic
985173005 4:187172450-187172472 CAGGGGGAACTTTCAGTGGCGGG + Intergenic
986139181 5:5013698-5013720 CTGGGGAAACATCCATTTCTTGG - Intergenic
989622036 5:43394045-43394067 CAGAGGAATCTTTCATTGGCAGG + Intronic
990911626 5:60857935-60857957 CAGTGTTAACATTGATTTGCTGG - Intergenic
994613805 5:102078406-102078428 CAGGGTGCACATTCATTGGCTGG - Intergenic
999502964 5:152165128-152165150 GAGGGGAAACTTTCATGTACTGG + Intergenic
1000594953 5:163204293-163204315 CAGTGGAAAAATTGATTTACAGG + Intergenic
1001016780 5:168149135-168149157 AAGGCGAGGCATTCATTTGCTGG + Intronic
1001454525 5:171850502-171850524 CAGGGGAGAGTTTCATTAGCTGG + Intergenic
1004055588 6:12134822-12134844 CAGAGGAAACACTCCTTTACTGG + Intronic
1005187868 6:23183161-23183183 TAGGGAGAACATTCATCTGCAGG + Intergenic
1006773039 6:36569674-36569696 AAGGTGAAACATTATTTTGCAGG - Intergenic
1006967029 6:37998007-37998029 CATGATAAACATTCATATGCAGG - Intronic
1011215281 6:84999069-84999091 CAGGGGAAATATTAAGTTGGAGG - Intergenic
1011995787 6:93586047-93586069 AAGGAGAAACCTTCATTTTCAGG - Intergenic
1013762878 6:113538514-113538536 AAGGGGATACATTTATTTGTGGG - Intergenic
1015714238 6:136174427-136174449 AAGGGGAGACACTCATTTTCTGG + Intronic
1016098941 6:140073981-140074003 CAGAGGAAAAAGTCATTTGGAGG + Intergenic
1021059375 7:16091423-16091445 CTGTGGAAAGATTCATTTGAAGG + Exonic
1024616932 7:51123692-51123714 CAGGGAAGTCATGCATTTGCTGG - Intronic
1024965775 7:55020685-55020707 CAGGGGAAACATGCCTTGGAAGG + Intronic
1025780096 7:64593941-64593963 CATGGGAATCATTCATTGCCAGG - Intergenic
1026052433 7:66958707-66958729 CAGGGGGAAGATGCATGTGCTGG - Intergenic
1026866992 7:73830134-73830156 CAGGGTAAACACCCATTTACTGG + Exonic
1036761252 8:11510193-11510215 GAGATGAAACATTCATTTGGGGG + Intronic
1040396136 8:47002129-47002151 CATGGGAGTCATTCATTAGCAGG + Intergenic
1041401471 8:57449970-57449992 CAGGGTACACTTTCATGTGCTGG - Intergenic
1046709877 8:117499084-117499106 AAGAGGAAACATTCAGTTGGTGG - Intergenic
1048568538 8:135629964-135629986 GAGGGGAAACATTCTGCTGCTGG + Intronic
1055999938 9:82204454-82204476 AAGGGGAAAAATTAATTTGTTGG - Intergenic
1056894976 9:90537016-90537038 CAGGGCAAAGATTCATTTTGGGG - Intergenic
1057567269 9:96176541-96176563 CATGGGAAACCTTTATTTCCTGG - Intergenic
1059296877 9:113279024-113279046 CTGTGGAAACATTGATCTGCCGG - Exonic
1060798645 9:126529483-126529505 CAGGAGAAACATTCTTCTGTGGG - Intergenic
1186959608 X:14721654-14721676 CAGGGGAAAAAATCATATACAGG - Intronic
1187027389 X:15449919-15449941 CAGAGAAAACATTTATTTGAAGG - Intronic
1188321859 X:28748614-28748636 CAAGGGAAAAATACATTTGAAGG - Intronic
1190594966 X:52043250-52043272 CAAGGGAAACATTCACAAGCCGG - Intergenic
1190613858 X:52210823-52210845 CAAGGGAAACATTCACAAGCCGG + Intergenic
1194464688 X:94218983-94219005 CAGTGGAAACCATCCTTTGCTGG - Intergenic
1201564087 Y:15347816-15347838 CAAGGGAAAGAGGCATTTGCAGG + Intergenic