ID: 928914248

View in Genome Browser
Species Human (GRCh38)
Location 2:36454909-36454931
Sequence CAGAAGGAGGATAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 0, 2: 8, 3: 83, 4: 823}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928914240_928914248 18 Left 928914240 2:36454868-36454890 CCATCTCTGGGATTAAGTAAGTT 0: 1
1: 0
2: 0
3: 15
4: 199
Right 928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG 0: 1
1: 0
2: 8
3: 83
4: 823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928914248 Original CRISPR CAGAAGGAGGATAAAGAGGC AGG Intronic
900099950 1:957841-957863 CAGAAGGGTGATGAAGAGCCAGG - Intronic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
901327022 1:8372938-8372960 GAGAAGGGGGATGAGGAGGCAGG + Intronic
901567847 1:10133612-10133634 AATAAAGAGGAGAAAGAGGCCGG + Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902295114 1:15461872-15461894 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902297979 1:15481411-15481433 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902836922 1:19053495-19053517 CGGAAGGAAGATCTAGAGGCGGG - Intergenic
903007543 1:20308661-20308683 CAGCAGGCAGATAAAGAGCCGGG - Intronic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903955399 1:27022008-27022030 CAGAAGGAAGATAAGGGGGAGGG + Intergenic
903964028 1:27074799-27074821 GAGAAGGAGGAAAGAAAGGCTGG - Intergenic
904619259 1:31765626-31765648 CAGAAGGAGGGAAAAGAGGGCGG - Intergenic
905212185 1:36381971-36381993 CAGGAGGAGGATGGAGAGGCAGG - Intronic
905327819 1:37170273-37170295 CAGAGGGAGGATAAATAGGGAGG - Intergenic
905356597 1:37389156-37389178 CAGAAGGAAGATGGAGAGGAAGG + Intergenic
905562475 1:38938399-38938421 ATGAAGGTGGATAAATAGGCAGG - Intronic
905777840 1:40681397-40681419 CAGAAGGAGGCTCAAGAGAGGGG - Intergenic
906002456 1:42438558-42438580 GAGTAGGAGGAGAAAAAGGCTGG - Intronic
906302015 1:44689650-44689672 CAGAGGGAGGGAAAAGAGACAGG - Intronic
906385644 1:45366381-45366403 CAGAAGGATGAATAAGTGGCTGG - Intronic
906536141 1:46551999-46552021 CAGCAGGAGGCTCAAGAGACAGG + Intergenic
906837530 1:49100136-49100158 CTGAAGGAGGAGAAAGAAGTAGG + Intronic
907124322 1:52035763-52035785 CATAAGGAGGAGGAAAAGGCAGG - Intronic
907416495 1:54318062-54318084 TAGAAAGAGGATGGAGAGGCCGG - Intronic
907703229 1:56810042-56810064 GAGAAGGAAGAGAAAGAGGAGGG + Intronic
907936683 1:59048125-59048147 CAGAGGGAGGGAAAAGAGGAAGG - Intergenic
908027408 1:59967534-59967556 CAGAAGGCAGATAACAAGGCAGG - Intergenic
908083761 1:60608656-60608678 CAGGAGGATGAGAAAGAGCCTGG - Intergenic
908239866 1:62179740-62179762 CAAAAGGAAAATAAAAAGGCTGG - Intergenic
908256673 1:62308916-62308938 GAGATGGAGGAAAAAGAGGCAGG - Intronic
909180309 1:72415673-72415695 CAGGAGCAGGACCAAGAGGCAGG - Intergenic
909588454 1:77318249-77318271 CAGGAGGAAGAAAGAGAGGCGGG + Intronic
909777724 1:79504037-79504059 CACGTGGAGGATAAAGAGACAGG - Intergenic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910481560 1:87663573-87663595 CAGATGGAGGATAAATAAGTAGG + Intergenic
910484798 1:87701321-87701343 GAGGAGGAGGCAAAAGAGGCAGG + Intergenic
910510874 1:88002512-88002534 AAGAAGGAGGATTGAGAAGCAGG + Intergenic
910691025 1:89965960-89965982 GAGATGGAGGATTAAGAGACGGG - Intergenic
910693991 1:89993552-89993574 CAAAAGGAAGAGGAAGAGGCTGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
912069567 1:105792792-105792814 GAGAAGGAGGAGAAAGAAGAGGG - Intergenic
912388060 1:109282492-109282514 AATAAGTGGGATAAAGAGGCTGG + Intronic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912554918 1:110508812-110508834 CAGAGGGAGGGCAAAGAGGATGG + Intergenic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913366199 1:118041957-118041979 GAGAAGAAGGGTAAAGAAGCTGG - Exonic
913454791 1:119019714-119019736 CAAAAGGAGGAAAAAGAGACTGG + Intergenic
913567161 1:120083996-120084018 CAGAAGGAACATAAGGAGACTGG - Intergenic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
913995300 1:143647281-143647303 CAGAAGCAGGTTAAAAAGGTGGG + Intergenic
914287911 1:146244703-146244725 CAGAAGGAACATAAGGAGACTGG - Intergenic
914360858 1:146934795-146934817 CGGAAGCAGGATAAAGAGGTGGG - Intergenic
914491727 1:148155842-148155864 CGGAAGCAGGATAAAGAGGTGGG + Intergenic
914548946 1:148695449-148695471 CAGAAGGAACATAAGGAGACTGG - Intergenic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914617735 1:149376269-149376291 CAGAAGGAACATAAGGAGACTGG + Intergenic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915488204 1:156236497-156236519 GAGAAGGAAGAGGAAGAGGCAGG - Intronic
916093869 1:161331100-161331122 CAGAAGGCAGAAACAGAGGCAGG - Intronic
916141517 1:161703615-161703637 GAGAAGGTGGATAGAGAGGAAGG + Intergenic
916168241 1:161982174-161982196 CGGAAGGAGGAAGCAGAGGCAGG - Intergenic
916240836 1:162637980-162638002 AAAAAGGAGGAAAAAGAGGATGG - Intronic
916282265 1:163064710-163064732 AAGAAAGAGGAGTAAGAGGCAGG + Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917002291 1:170373551-170373573 CAAAGGGAGGATAATGAGGCTGG + Intergenic
917547103 1:175982416-175982438 GAGAAGGAGGAGAAAGAAGTGGG - Intronic
917791813 1:178503981-178504003 CAGCAGGAGGCTGCAGAGGCGGG + Intergenic
917895548 1:179484012-179484034 CAGAGGGAAGATAGAGATGCTGG + Intronic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919788799 1:201276934-201276956 GAGAGGGTGGATAGAGAGGCAGG + Intergenic
920008429 1:202850446-202850468 CAGAAGGAAGGGAAAGAGGTTGG - Intergenic
920176057 1:204102619-204102641 CAGATGGAGGAGGAAGAGGGTGG + Intronic
920457871 1:206114878-206114900 CAGAAGCAGGATAAAGAGGAGGG + Intronic
920776563 1:208943786-208943808 GAGAAAGAGGAGAAAGAGGGTGG + Intergenic
920983073 1:210856528-210856550 GAGAATGAGGAAGAAGAGGCTGG - Intronic
921026207 1:211284907-211284929 CAGAAGCAGAATAGAGAGCCAGG - Intronic
921133841 1:212242797-212242819 CAGAAGGTGGCTAGAGAGCCCGG - Intergenic
921191560 1:212713420-212713442 CAGATGGGGGAGAAAGGGGCTGG - Intergenic
922141063 1:222887291-222887313 CAGAAGGATGACATACAGGCAGG - Intronic
922564703 1:226594088-226594110 GAGGAGGAGGAAAACGAGGCAGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
923327372 1:232892621-232892643 AAGAAGGAGGCAAAAGAGGAGGG + Intergenic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923513506 1:234674232-234674254 CTGAAGGTGGATGAAGATGCAGG + Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923893063 1:238237051-238237073 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
923927458 1:238649060-238649082 CAGAAGGTGAAAAAAGAAGCAGG + Intergenic
924139430 1:241006805-241006827 GAGGAGGAGGATGAAGAGGAGGG - Intronic
924183902 1:241466680-241466702 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924441813 1:244092572-244092594 GAGAAGGAGGATTCAAAGGCGGG - Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1063035460 10:2282391-2282413 CAGATGGAGAAGGAAGAGGCAGG + Intergenic
1063081921 10:2775457-2775479 CAGAAGGGTGGAAAAGAGGCAGG - Intergenic
1063160294 10:3413689-3413711 CATAAGGAAGAAACAGAGGCTGG + Intergenic
1063264856 10:4436316-4436338 CAGTAGGTGGAGAAAGAGGGAGG + Intergenic
1063468927 10:6268723-6268745 CATAAAGAGGTTAAAGAGGCTGG + Intergenic
1063879507 10:10516927-10516949 CGGAAGGAGAAAAAAGAGGTGGG - Intergenic
1064231179 10:13529850-13529872 CAGGAAGAGGGTAAAGAGTCGGG + Intergenic
1064272669 10:13879659-13879681 AAGAAGGAGGAGGAAGAGGAAGG - Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064714323 10:18161072-18161094 CAGTTGGAGGATAAAGAAGAGGG + Intronic
1065176923 10:23086540-23086562 CAGAAGGAAGAGAGAGAGGTGGG + Intergenic
1065400752 10:25297645-25297667 CAGATGGAGATTAAAGACGCAGG + Intronic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1065505533 10:26426707-26426729 CAGAAAAAGGATAAAAAGGTTGG + Intergenic
1065588288 10:27241018-27241040 CAGAAGGGGGAAACCGAGGCCGG + Intronic
1065738536 10:28775730-28775752 CAGGAGGAAGAGAGAGAGGCAGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066247478 10:33597439-33597461 CAGGAGGAGGATAGAGATGGGGG - Intergenic
1067144893 10:43687835-43687857 CAGAAGTAGGAAGAAGAGGGAGG + Intergenic
1067998145 10:51299500-51299522 AAGAATGAGCAAAAAGAGGCGGG - Intronic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068568963 10:58607482-58607504 GAGAAGGAGGATAAAGGAGGTGG - Intronic
1069074458 10:64023859-64023881 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1070208579 10:74290226-74290248 CAGGAAGAGTATAAAGAAGCAGG - Intronic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1071584440 10:86805974-86805996 GAGAAGGAGATTAAAGAGGCAGG - Intronic
1071820119 10:89271426-89271448 CATAAGGAGTACAAAGTGGCTGG - Intronic
1072629759 10:97137418-97137440 CAGGATGAGGATTAAGATGCTGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072924778 10:99607469-99607491 CAAAAGGAGGATAGATAGGTTGG + Intergenic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1073771820 10:106743252-106743274 CAGAATGAGGATAGAAAGGGAGG + Intronic
1074423726 10:113332129-113332151 CAGGAGGAGAATAAAGTGTCAGG + Intergenic
1074447418 10:113532057-113532079 AAGAAGGATGAAAGAGAGGCAGG - Intergenic
1074560270 10:114529416-114529438 TAGAAAGAGGATGAAGAGGCCGG - Intronic
1075349514 10:121711058-121711080 GAGAAGGAAGATAAAGAAGTGGG - Intergenic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1075762132 10:124864835-124864857 CAACAGGAGGAGAGAGAGGCAGG + Intergenic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1077338513 11:2015947-2015969 CCGAAGGAGGATGGAGGGGCCGG + Intergenic
1078402885 11:11043984-11044006 CAAAAGGAGGATTCAGAGTCTGG + Intergenic
1078453043 11:11454452-11454474 GAGAAGGAAGATAAGGAGGGAGG + Intronic
1078534608 11:12163022-12163044 CAGGAGGAAGAGAAAGAGACAGG - Intronic
1078846841 11:15126177-15126199 CAGATGGAGGAATAATAGGCTGG + Intronic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1079875621 11:25853478-25853500 CAGAAGCAGAGTGAAGAGGCGGG + Intergenic
1080090451 11:28342111-28342133 CAGAAGGAAAATAAAAAGACAGG + Intergenic
1080273291 11:30473717-30473739 CAGAAGGAGCAGAAAGATGCAGG - Intronic
1080442995 11:32312646-32312668 CATAAGGAAAATAAAGAGGCAGG + Intergenic
1081666457 11:44919761-44919783 CAGGAGGAGGACACAGGGGCGGG - Intronic
1081732255 11:45379883-45379905 GAGGAGGAGGATAAGGATGCAGG - Intergenic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082693130 11:56329149-56329171 CAAAAGGAAAATAAAAAGGCTGG - Intergenic
1082727040 11:56748571-56748593 CAGAAGGGGGATACAGAATCTGG - Intergenic
1083962283 11:66021080-66021102 CAGCACCAGGATACAGAGGCAGG + Exonic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084328650 11:68416612-68416634 CAGAGGGAGGAAACAGAGGATGG + Intronic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1085406157 11:76263636-76263658 TAGAAGGAGGATATAGTGGCAGG - Intergenic
1085442017 11:76573899-76573921 AAGAAGGAGGAGAAAGAGAATGG - Intergenic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086626644 11:88963494-88963516 CAGAAGGAAGATAAAAGGGATGG - Intronic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086788173 11:90998880-90998902 CAGAAGGAAGAGAAAAATGCAGG + Intergenic
1086954398 11:92920776-92920798 GAGAAGGAGAATAAAGAAGCAGG + Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087204244 11:95377399-95377421 GAGAAGGAGTAGAAAGGGGCAGG - Intergenic
1087223282 11:95569510-95569532 TAGAAGGATGATAAAGAGCAAGG - Intergenic
1087377869 11:97367337-97367359 CAGAAGGAAGACACAGAAGCTGG + Intergenic
1087814027 11:102638733-102638755 CAGCAGGAGGGTAAAGAGCCAGG + Intergenic
1088490107 11:110378686-110378708 GAGAAGGAGGGTAAAGGGCCTGG - Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1088807440 11:113365360-113365382 AAGAAGGAGGATAAAGAGACAGG - Intronic
1088963506 11:114694538-114694560 CAAAAGGAGAATAAAGAGAAAGG - Intronic
1089256794 11:117198459-117198481 GAGAAGGAGGCTCAGGAGGCTGG - Intergenic
1090105733 11:123852158-123852180 CAGAGGGATGACACAGAGGCTGG - Intergenic
1090319884 11:125833074-125833096 CAGAGGGAGGATGGAGAGTCAGG + Intergenic
1090484096 11:127096646-127096668 CAGAATGAGGGAAAAGAGGAAGG + Intergenic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1090920112 11:131199370-131199392 TTGAAGCAGGATAATGAGGCTGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1202821497 11_KI270721v1_random:71129-71151 CCGAAGGAGGATGGAGGGGCCGG + Intergenic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092598555 12:10033974-10033996 CACAAGGAGGAGACAGAGGATGG + Intronic
1092964621 12:13629633-13629655 GAGAAGGAGGAGCAAGAGGAGGG - Intronic
1093322406 12:17729009-17729031 CAGAAGCCAGATAAAGAGGTGGG - Intergenic
1093794940 12:23300395-23300417 CAAAAGGAGAATAAAGATGAAGG - Intergenic
1094088137 12:26616815-26616837 CAGGAGGAGGAGGAAGAGGGAGG - Intronic
1094242354 12:28242892-28242914 CAGAAGTAGGAGCAAGAGGGGGG - Intronic
1094732865 12:33198847-33198869 CAGAAGGAGGCTTAAGAAGGTGG - Intergenic
1095259591 12:40082928-40082950 CAGAAGAAGGATACAGACCCCGG - Intronic
1095508076 12:42919845-42919867 CAGAGGGAGGAACAAGAGCCAGG - Intergenic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1095897967 12:47299784-47299806 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1095952255 12:47787996-47788018 CAGGAGGAGGTCAATGAGGCTGG + Intronic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096051013 12:48607436-48607458 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
1096389571 12:51217995-51218017 CAGAAGGAGGGAAAAAAGGGGGG - Intergenic
1096961018 12:55577677-55577699 CAGAAAGAAGATAAATAGGGAGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098465078 12:70777680-70777702 CAGAAGGAAGAAAGAGAGGGTGG - Intronic
1098469089 12:70823755-70823777 CACACGGAGGATTCAGAGGCAGG + Intronic
1098911644 12:76215107-76215129 CAGAAGCAAGATAATGAGGGGGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099643391 12:85319524-85319546 GAGGAGGAGGACAAAGAGGAGGG - Intergenic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1099697998 12:86045071-86045093 CAGAAGGAGGACACAGACCCTGG - Intronic
1101009326 12:100432488-100432510 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1101282803 12:103276843-103276865 TAGAAGGAGGATGATGAGGAGGG - Intronic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1102320187 12:111926575-111926597 CAGAAGAAGGATCAAGAGGGAGG - Intergenic
1102461055 12:113099887-113099909 CGGAAGGAGGAGCAAGAGCCAGG - Exonic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1102857293 12:116305437-116305459 GAGAAAGAAGATAAAGAAGCTGG + Intergenic
1102872116 12:116422047-116422069 CAGAAGAGAGATACAGAGGCTGG - Intergenic
1103238164 12:119391789-119391811 CAGAAGGAAGAAAAAGATACTGG - Intronic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103825093 12:123731674-123731696 TAGAACCAGGAAAAAGAGGCTGG - Intronic
1103845528 12:123899437-123899459 CAGCAGGAGAAGGAAGAGGCAGG - Intronic
1103896643 12:124277771-124277793 GAGAAGGAGGAGGAAGAGGAAGG - Intronic
1104117691 12:125765267-125765289 GAGAAGGAGTATAAAAAGGAGGG + Intergenic
1104875329 12:132029779-132029801 CAGAATGAGGATCTTGAGGCAGG + Exonic
1105398636 13:20066668-20066690 TAGAAGGAGGTTGGAGAGGCAGG + Intronic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107015602 13:35706093-35706115 CAGCAGGAGGCTAAAGACACAGG + Intergenic
1107554250 13:41503688-41503710 GAAAAGGAGGATGAAGAGGAAGG + Intergenic
1107668587 13:42718680-42718702 AAGAAGGAGGAGAAAGAAGAGGG + Intergenic
1107672652 13:42761776-42761798 CAGAAAGTAGACAAAGAGGCTGG - Intergenic
1108744972 13:53384111-53384133 GAGGAGGAGGAGAAAGATGCAGG - Intergenic
1108801436 13:54100982-54101004 CAGAATGAGGAAAAAAAGGGGGG - Intergenic
1108882434 13:55137105-55137127 CAGGAGTAGGAGAAAGAGACCGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1110319380 13:74143062-74143084 GAGAAGGAGGAAAGAGAGGAAGG - Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1110499169 13:76206030-76206052 TAGAAGGAGGATACACAAGCAGG - Intergenic
1110539730 13:76694697-76694719 CAGAAGGAGGATCCAGAGAAAGG + Intergenic
1110594221 13:77301105-77301127 CTGAAGGATGATAGAGAGGCTGG + Intronic
1110629492 13:77691106-77691128 CAGAAGGATGATACAGACTCAGG - Intergenic
1111231804 13:85354082-85354104 CAGAGGGAAGATACAGAAGCTGG + Intergenic
1111391467 13:87601017-87601039 GAGAAGGAGGAGAAAGATGATGG + Intergenic
1111659230 13:91188830-91188852 CAGAGGGAGGATAAAGAGAATGG + Intergenic
1112230078 13:97580968-97580990 CAAAACTAGGATAATGAGGCCGG - Intergenic
1113303875 13:109054965-109054987 AAGAAGGAGGAAAAGGAGGGAGG - Intronic
1114241796 14:20874793-20874815 CAAAAGGAGGAAAAGGAGGAGGG + Intergenic
1114384733 14:22243105-22243127 AAGAAGGAGGTTAAAGATACAGG - Intergenic
1115286145 14:31714534-31714556 CAGAAGGAAGAGAGACAGGCGGG + Intronic
1115351957 14:32405265-32405287 CAGAAGCAGGAAGAAGAGGAAGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116565253 14:46437601-46437623 CAGAATGAGGCTTAAGATGCTGG + Intergenic
1116649140 14:47566770-47566792 CAGAGGGAGGACACAGATGCTGG - Intronic
1117034786 14:51716835-51716857 CAGGAGGAGGATGAAGAAGCAGG + Intronic
1118140284 14:63072850-63072872 GAGAAGGAGGATGAGGAGGAGGG - Intronic
1118186373 14:63542546-63542568 CAGAAGGTGGAGAAAAAGGGGGG + Intronic
1118268388 14:64317466-64317488 CAGAAGCAAGATAGAGAGACAGG + Intronic
1118335601 14:64851202-64851224 CAGTACAAGGATTAAGAGGCAGG + Intronic
1118336986 14:64861905-64861927 CACAATGAGGATGAAGAGCCAGG - Intronic
1118350689 14:64971328-64971350 CTGAGGGAGGCTAAAGAGGATGG - Intronic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1119386764 14:74262093-74262115 CAGAAGGATGGGAAAAAGGCTGG + Exonic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119731165 14:76952097-76952119 GGGAAGGAGGATAAGGATGCTGG - Intergenic
1119894616 14:78209330-78209352 CTGAAGGAGAACACAGAGGCTGG + Intergenic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120057952 14:79947620-79947642 AAGCATGAGGATAAAGGGGCTGG - Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120448213 14:84629370-84629392 CAAAAAGAGCATGAAGAGGCTGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121058686 14:90883228-90883250 CAGAAGGAGAAGAAAGAGAAAGG - Intronic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121494364 14:94381725-94381747 CAGAAGGAGGAGACTGGGGCTGG + Intronic
1121799663 14:96764054-96764076 CAGAAGGAGGAAGGAGTGGCAGG + Intergenic
1123721196 15:23063512-23063534 CAGAGGGAGGACACAGATGCTGG + Intergenic
1123893820 15:24808925-24808947 CAGAGGGAGAATACAGATGCTGG + Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1125379702 15:39074860-39074882 CAGAAGGTGGATAAAGATACAGG + Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1126139452 15:45425267-45425289 GAGAAGGAGGAAGAAGAGGAGGG - Intergenic
1126690387 15:51284725-51284747 CAAAAGGAAAATAAAAAGGCTGG + Intronic
1126858887 15:52864930-52864952 CAGAAGGAGGTAAGTGAGGCTGG - Intergenic
1127013024 15:54650755-54650777 CAGAAGGAAGAAAAAGAAGGGGG + Intergenic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1127768793 15:62213512-62213534 CAAAAGGAAAATAAAAAGGCTGG - Intergenic
1127828768 15:62730803-62730825 CCAAAGGAGGATAAATATGCAGG - Intronic
1128478368 15:68016550-68016572 CAGGAGGAAGAGAGAGAGGCAGG - Intergenic
1129327552 15:74809133-74809155 CTGGAGGAGGATGAAGGGGCTGG + Intergenic
1129531347 15:76267784-76267806 CAAAAGGAAAATAAAAAGGCTGG + Intronic
1130100566 15:80890632-80890654 CTGAAGGAGGATAAAATGGGTGG - Intronic
1130324681 15:82870372-82870394 GAGAGGGAGGAGGAAGAGGCTGG - Intronic
1130577035 15:85102179-85102201 GAGAAGGAGGAAACAGAAGCAGG + Intronic
1130693839 15:86110507-86110529 GAGAAGGAGAAGGAAGAGGCGGG + Intergenic
1131527569 15:93164796-93164818 CAAAAGCAGGATCAAGGGGCAGG - Intergenic
1131661285 15:94520470-94520492 CAGTAGGATTACAAAGAGGCTGG + Intergenic
1131783993 15:95891745-95891767 CAAAAGGAAGATAAAGAACCAGG + Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1132118897 15:99159553-99159575 CAGGAGGAGGAAACAGAAGCTGG + Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132491538 16:234579-234601 GAGAAGGAGGGGAAAGAGGACGG + Exonic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132888413 16:2192734-2192756 CAGAAGGAGGTTGACGTGGCTGG - Intronic
1133026784 16:2992076-2992098 TAGAAGGAGGAAGCAGAGGCAGG - Intergenic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133846711 16:9461049-9461071 AAGAAGGAGGAAAAGGATGCAGG + Intergenic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1136939665 16:34510988-34511010 AAGAAGGAGGAAAAGGAGGGCGG - Intergenic
1136960155 16:34837572-34837594 AAGAAGGAGGAAAAGGAGGGCGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138640987 16:58386669-58386691 GAGAAGGAGGAAGAAGAGGAAGG - Intronic
1138692089 16:58777581-58777603 CAAAAGGAAGAGAGAGAGGCTGG - Intergenic
1138961948 16:62037560-62037582 CAGAAGGGGGAAAAAGGTGCAGG + Intergenic
1139021054 16:62749897-62749919 AAGGAGGAGGAAGAAGAGGCAGG + Intergenic
1139718713 16:68835613-68835635 CAAAACGTGGAGAAAGAGGCCGG + Intergenic
1140288534 16:73627961-73627983 GAGAAGTAGCATGAAGAGGCAGG + Intergenic
1140470896 16:75213745-75213767 CAGAACAAGGATAAAGAACCCGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141185548 16:81784490-81784512 AAGAAGGAGGAGTGAGAGGCTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142832165 17:2557386-2557408 AAGAAGGAAGATGAAGAGGAAGG + Intergenic
1143069157 17:4275993-4276015 CAGAAGGAAGAGACAGAGACTGG - Intronic
1143367871 17:6420279-6420301 CAGAAGCAGAATGAAGATGCGGG + Intronic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1144279151 17:13707125-13707147 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1144330961 17:14223816-14223838 AAGAAGGAGAATAAACAGACTGG - Intergenic
1145961202 17:28887439-28887461 CAGAGGGAGGATGTAGAGCCTGG + Intronic
1146721096 17:35124077-35124099 CAGGAGGAGGCTGATGAGGCTGG + Intronic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147390821 17:40108136-40108158 CAGAAGCAGGATAAAGCGCAAGG + Intergenic
1147420824 17:40321429-40321451 GAGGAGGAGGAGGAAGAGGCAGG + Intronic
1147583398 17:41639058-41639080 AAGAGGGAGGAAAAAGAGGGAGG - Intergenic
1148005491 17:44425189-44425211 CAGAAGGATGAGAAAGGGACAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149081280 17:52660544-52660566 CAGAAGGAGAAGGAAGAGGTAGG + Intergenic
1149593221 17:57847364-57847386 AAAAAAGAGAATAAAGAGGCCGG + Intronic
1149998592 17:61417728-61417750 CTGACGGAGGAAGAAGAGGCAGG - Intergenic
1150090631 17:62321977-62321999 GAGAAGTAAGATAAAAAGGCAGG + Intergenic
1150244583 17:63664821-63664843 CAGAAGTGGGAAAAAGAGGAAGG - Intronic
1151162913 17:72180843-72180865 CAGAAGAAGGGTTAAGATGCTGG + Intergenic
1151588710 17:75028892-75028914 CAAAAGGAAAATAAAAAGGCTGG + Intergenic
1151755795 17:76074696-76074718 CAGGAGGAGGAGCAAGAGACAGG - Intronic
1151967799 17:77440648-77440670 CAGAAGCAGGGAGAAGAGGCAGG + Intronic
1152688176 17:81704936-81704958 CTGAGAGAGGAAAAAGAGGCTGG + Intronic
1153017587 18:597378-597400 CAGGAGGAGGAGGTAGAGGCGGG + Intronic
1153433744 18:5047077-5047099 CAGAAGGAGGAAAGAGGGTCAGG + Intergenic
1154305356 18:13226865-13226887 AAGAGGGAGGATGAGGAGGCTGG - Intronic
1154465824 18:14642156-14642178 TAGAAGGAGGAAAGAGAGGGTGG - Intergenic
1155148567 18:23104304-23104326 AAGAAGGAGGATCAGGAGGGAGG + Intergenic
1155935837 18:31752793-31752815 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156244205 18:35282661-35282683 CTGAAGGAGGATCTAGAGGATGG - Intronic
1156422263 18:36967692-36967714 CAGAAGGAAGAAACAGATGCTGG + Intronic
1156481022 18:37436506-37436528 CAGAGGGGGGATCAAGAGCCAGG + Intronic
1156535533 18:37861158-37861180 CCGAAGGAGGATGATGAGGAGGG - Intergenic
1157140667 18:45103078-45103100 CAGCAGGAGTCTAAAGAGGGAGG - Intergenic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157793140 18:50550832-50550854 CAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158032398 18:52982170-52982192 CAGAGGGAGGATAGAGGGGCAGG + Intronic
1158369792 18:56787557-56787579 CAAAAGGAAGCTAAAAAGGCAGG - Intronic
1158450443 18:57559258-57559280 AGAAAGGAGGATAAAGAGGAAGG + Intronic
1158495285 18:57949708-57949730 CAGAGGGAGGAAAGAAAGGCGGG + Intergenic
1158555642 18:58472549-58472571 TGGAAGAAGGATAAAGAGCCTGG + Intergenic
1158571259 18:58598534-58598556 CATGAGGAGGAGAAATAGGCTGG + Intronic
1158984000 18:62794989-62795011 CTGATGGATAATAAAGAGGCTGG - Intronic
1159024859 18:63174521-63174543 TATAAAGAGCATAAAGAGGCTGG + Intronic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1159728551 18:71995054-71995076 CAGAAGGAAGAGAAAGATGGGGG + Intergenic
1160475705 18:79184809-79184831 CAGGAGGAGGATGCAGAGGGTGG - Intronic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1160968333 19:1756229-1756251 CAGAAGGGGGAAACTGAGGCCGG - Intronic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161019073 19:1999368-1999390 TGGAAGGAGGAGAAACAGGCCGG + Intronic
1161042009 19:2115326-2115348 CAAGAGGAGGAAAAAGAGGAAGG - Exonic
1161788856 19:6346464-6346486 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162024157 19:7884395-7884417 GAGAAGGAGGGGAAAGAGGGAGG + Intergenic
1162300714 19:9843289-9843311 CAGAAGGAGGGGCTAGAGGCTGG - Intronic
1162475085 19:10895043-10895065 CAGATAGAGAATAAGGAGGCCGG - Intronic
1162735199 19:12743169-12743191 GAGGAGGAAGATAAAGAGGGAGG + Intronic
1163227591 19:15975485-15975507 TAGAAGCAGGATAAAGAGGTGGG + Intergenic
1163274611 19:16275602-16275624 CAGAATGGGGATACTGAGGCTGG + Intergenic
1163606667 19:18279659-18279681 CAGAGGGAGGAGAGAAAGGCGGG + Intergenic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164250197 19:23469100-23469122 GAGAAGGAGGAGAAAGAGAAGGG - Intergenic
1164591934 19:29512167-29512189 GAGAAAGAGGATGAAGAGGAAGG + Intergenic
1164592101 19:29512770-29512792 GAGACGGGGGATAAAGAGGGAGG + Intergenic
1164592462 19:29514065-29514087 AAGAGGGAGGATAAGGAGGAAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164795358 19:31022483-31022505 CAGAAAGAGGAAGAAGAGGGAGG - Intergenic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1165344167 19:35233313-35233335 CAGAAAGTGGAAGAAGAGGCAGG + Intergenic
1165426718 19:35750031-35750053 CAGAAGGGGGACACTGAGGCAGG + Intronic
1165924233 19:39317285-39317307 CTGAAGGCGGAAAAAGAGGCCGG + Intergenic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166195626 19:41203811-41203833 AAGAAGGAGAAGAAAGATGCAGG - Intronic
1166240301 19:41486871-41486893 CAGATGGAGTCTACAGAGGCAGG - Intergenic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1166902394 19:46075335-46075357 CAAGAGGAGGCTAAAGAGACAGG - Intronic
1167427780 19:49438339-49438361 GAGACGGAGGATAGACAGGCTGG + Intronic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167910878 19:52700778-52700800 CTGAAGGAGGAGAAAGTGACAGG + Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
1167964045 19:53129083-53129105 CCGAAGGAGGAAAAAGGGACAGG + Intronic
1168101541 19:54144099-54144121 CAGAAGGAGAAGGAAGAGGTTGG + Exonic
1168156068 19:54473501-54473523 CAGCAGGAGGATGAAGAGCATGG + Intergenic
1168588163 19:57611397-57611419 AGGAAGGAGAATAAAGAGCCTGG - Intronic
1168664265 19:58191436-58191458 CAAAAGGAAGATCAGGAGGCTGG - Intronic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
926423978 2:12724730-12724752 CAGAAGGAGAAATATGAGGCTGG - Intronic
926550781 2:14298645-14298667 CACAAGGAAGAGACAGAGGCTGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926626116 2:15091361-15091383 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
926696629 2:15774067-15774089 CAGAAGGAGAAGCAAGGGGCTGG + Intergenic
926987330 2:18639198-18639220 CACAAAGATGAGAAAGAGGCCGG - Intergenic
927078907 2:19608642-19608664 GAGAAGGAGGAGAAAGTGGGAGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927460600 2:23295219-23295241 CAGAAGAAGGTTAGAGAGGGAGG + Intergenic
927792667 2:26022625-26022647 AAGAAGGGGGAAAAATAGGCTGG - Intergenic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929538218 2:42798510-42798532 CATAAAGAGGCTCAAGAGGCCGG - Intergenic
930031000 2:47057949-47057971 CACAAGGAGGAGAAAGAGTGGGG - Intronic
930545905 2:52766651-52766673 CAGAAGTAGGCTAAAGAAGATGG + Intergenic
930893732 2:56421576-56421598 CAGGAGGAGTCTACAGAGGCAGG - Intergenic
931831991 2:66062326-66062348 CAGAAGAAGAATACAGAAGCAGG + Intergenic
932702303 2:74000252-74000274 CACAAGGAGGGTGGAGAGGCAGG - Intronic
932846637 2:75142166-75142188 CAGAAGGTGGAAGCAGAGGCTGG - Intronic
932996243 2:76857132-76857154 GAGAAGGAGGAAGAAGAGGAGGG - Intronic
933570092 2:84000319-84000341 CACAAGGAGGGTAGAGAGACAGG + Intergenic
933614751 2:84472063-84472085 CAAAAGGAAAATAAAAAGGCTGG - Intergenic
933766233 2:85711449-85711471 CAGAAGGAGGATGACGGGGGTGG + Intergenic
934016200 2:87886327-87886349 GAAAAGGAAGATAAAGGGGCAGG - Intergenic
934034644 2:88078777-88078799 GAGAAGGAGGATGCAGAGTCAGG - Intronic
934547247 2:95228076-95228098 CTGAAGGAAACTAAAGAGGCAGG - Intronic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
935933452 2:108154902-108154924 CAGGAGTAGGATAAAGAACCAGG + Intergenic
936004430 2:108870405-108870427 CAGAAGGAGAAAAAAGAGAAAGG + Intronic
936120249 2:109736199-109736221 CAGAAGGGGGCTACCGAGGCTGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936395558 2:112125623-112125645 GAGAAGGAGGAGGAAGAGGAAGG + Intergenic
936666307 2:114600126-114600148 CAGAAGGAAGACAAAGAGATTGG - Intronic
936960096 2:118063998-118064020 CTCAAGTAGGAGAAAGAGGCAGG + Intergenic
937328949 2:121011120-121011142 CAAAAGGAGAAAAAAGAGACAGG + Intergenic
937609744 2:123846423-123846445 TAGAAGGAGGATGGAGAGGGGGG + Intergenic
938113539 2:128587875-128587897 AAGAAGGAAGAGAAAGAGGTGGG + Intergenic
938412454 2:131076130-131076152 GAGAATGAGAAAAAAGAGGCTGG - Intronic
939201230 2:139037686-139037708 GACAGTGAGGATAAAGAGGCAGG - Intergenic
939387540 2:141520090-141520112 TAGAAGGAGAATAAAGAAACTGG + Intronic
939875961 2:147578031-147578053 CAGAAGGAGAATAACCAGGGAGG + Intergenic
940037213 2:149323562-149323584 CAAAAGGAAAATAAAAAGGCTGG + Intergenic
940464863 2:154014457-154014479 CGGAAGGAGGATGAAGATACTGG - Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941247367 2:163116198-163116220 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
941387849 2:164875069-164875091 CAGGAGGAGGAAGAAGAGGAGGG + Intergenic
942241481 2:173966248-173966270 TACCAAGAGGATAAAGAGGCCGG - Intergenic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
943104622 2:183529099-183529121 CAGAAGCTGGAGCAAGAGGCAGG - Intergenic
943483264 2:188448859-188448881 GAGAAGGAGGAAAAAGGGGAGGG - Intronic
943888726 2:193257394-193257416 CAGAAAGAGAATAAAATGGCAGG + Intergenic
944165682 2:196717593-196717615 AAGAAGCAGGATAAAGGGGCGGG + Intronic
944489124 2:200239185-200239207 AAGAAGGAGACAAAAGAGGCAGG + Intergenic
944522599 2:200586949-200586971 CTGAAGGAGGAAACTGAGGCAGG + Intronic
944855296 2:203761456-203761478 TAGAAGGAGCAAAAAGAGACAGG - Intergenic
945020584 2:205567201-205567223 AAGAGGGAGGATAGAGAGGAAGG + Intronic
945915110 2:215695561-215695583 AAGAAGACTGATAAAGAGGCAGG + Intergenic
945961395 2:216138999-216139021 TAGAAGGAAGATAAAGATACAGG - Intronic
946197511 2:218043923-218043945 CAGAAGGGGGCTGAGGAGGCAGG + Intronic
946476794 2:220014333-220014355 CAGAAGGAAGACAAAGAGAGAGG - Intergenic
946805190 2:223464320-223464342 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
946922199 2:224591675-224591697 CGGAAGGAGGAAAGTGAGGCGGG - Intergenic
948012387 2:234659969-234659991 CAAAAGGAAGATTAAAAGGCTGG + Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948422298 2:237867313-237867335 AAGAAGGAGGAGCAAGAGGAGGG + Intronic
948483294 2:238263922-238263944 CTGAAGGAGGAAGAAGAGGAAGG + Intronic
948580108 2:238981279-238981301 AACAAGGAGGCTAAAGATGCAGG + Intergenic
948654868 2:239470345-239470367 CATAAAGAGCAGAAAGAGGCTGG - Intergenic
948734851 2:239995521-239995543 GAGAAGGCAGAAAAAGAGGCAGG + Intronic
948989490 2:241545618-241545640 CAGAAGGAGGACAGAGAGGGAGG + Intergenic
1168735071 20:127725-127747 CAGAAGGAGAAGAAAGAGAAAGG + Intergenic
1169030278 20:2401328-2401350 CAGGAGGAGGATGGGGAGGCTGG - Intronic
1169140453 20:3224609-3224631 CACAAGGAGGCTCAGGAGGCTGG - Intergenic
1170136079 20:13074955-13074977 TAAAAGGAAAATAAAGAGGCAGG - Intronic
1170483931 20:16795750-16795772 GACAAGGAGGAGAAAGAGGAGGG + Intergenic
1170488408 20:16844331-16844353 CAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1170779591 20:19412421-19412443 GAGAAGGAGGAAGAAGAGACAGG + Intronic
1171188106 20:23137663-23137685 GAGAAGGAGGCTAATGGGGCAGG + Intergenic
1171367312 20:24634047-24634069 CAGAAGGAGGAGGAAGAGAATGG + Intronic
1172191208 20:33062980-33063002 CAGCTGGAGGATGAAGGGGCTGG + Intronic
1172270442 20:33652760-33652782 CAGAAAGAGAGCAAAGAGGCCGG + Intergenic
1172761607 20:37327354-37327376 CAGAAGAAGGCCAAAGAAGCTGG - Intergenic
1172925051 20:38526360-38526382 CGGGAGGAAGAGAAAGAGGCAGG - Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1173639496 20:44590737-44590759 CACAAAGAGGCTAAAGAGCCTGG + Intronic
1173652927 20:44678742-44678764 CAGAAGGGGGTTAATGTGGCTGG + Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174310318 20:49648256-49648278 AAGAAAGAAGAGAAAGAGGCTGG + Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175270540 20:57730855-57730877 CTGAAGGGTGAGAAAGAGGCAGG - Intergenic
1175681575 20:60992923-60992945 CAGCAGGGTGAAAAAGAGGCAGG + Intergenic
1176808763 21:13516438-13516460 TAGAAGGAGGAAAGAGAGGGTGG + Intergenic
1177169725 21:17641662-17641684 CAGAAGGAGGCTAGAGAGGTGGG + Intergenic
1178261340 21:31102603-31102625 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1179159402 21:38880108-38880130 CAGAGGTTGGAAAAAGAGGCTGG - Intergenic
1179336747 21:40463769-40463791 AAGAAGGATGCCAAAGAGGCTGG - Intronic
1179393515 21:41015710-41015732 AAAAAAGAGGATAAAAAGGCAGG + Intergenic
1179521215 21:41946474-41946496 CAGGAGGGGGAGAAAGAGGCGGG - Intronic
1179572677 21:42287134-42287156 CACAGGGAGGACACAGAGGCAGG + Intronic
1179986157 21:44921310-44921332 GCCAAGGAGGATAAAGAGGTGGG + Intronic
1180798621 22:18620645-18620667 AAGAAGGAGGATAGAAAGGAAGG + Intergenic
1181119921 22:20658698-20658720 CGGAAGGGGGAAAAAGAGGGTGG + Intergenic
1181223095 22:21374619-21374641 AAGAAGGAGGATAGAAAGGAAGG - Intergenic
1181255643 22:21561015-21561037 AAGAAGGAGGATAGAAAGGAAGG + Intronic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1181819197 22:25462560-25462582 CAGAAGGGGGAGGAAGAGGGAGG - Intergenic
1181946744 22:26523877-26523899 CTGAAAGAAAATAAAGAGGCCGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182764079 22:32745846-32745868 CAGAGGCAGGATCAAAAGGCAGG + Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
1183653430 22:39171787-39171809 CGGATGGAGGATAGAGGGGCAGG + Intergenic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184019139 22:41808913-41808935 CAAAAGCAGGACAAAGAGGAAGG - Exonic
1184050187 22:41998609-41998631 GAGAAAGGGGAGAAAGAGGCGGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184384184 22:44164922-44164944 CAAGAGGAGGATGAACAGGCAGG - Intronic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1184699433 22:46160524-46160546 CAGAGGGCGGATCATGAGGCCGG - Intronic
1184899424 22:47435233-47435255 CACAAGGAGGAGACAGAGCCAGG + Intergenic
1185101849 22:48844790-48844812 CAGAAGGAGGACAGAGAGGGAGG - Intronic
949344876 3:3067561-3067583 CAGAATGAGAATCCAGAGGCGGG + Intronic
949355763 3:3179346-3179368 CACAAGGAGGATGGAGAGGATGG + Intronic
949663919 3:6314675-6314697 GATAAGGAGGACAAAGAAGCTGG - Intergenic
950114884 3:10444362-10444384 CAGCAGGAGGATGTGGAGGCAGG - Intronic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
950807053 3:15614409-15614431 CAGAAGGAGAAAATAGAGGCTGG - Intronic
951033010 3:17903788-17903810 GAGGAGGAGGACAAAGAGGAAGG - Intronic
951117334 3:18880392-18880414 CAGAAGGAGGAGAAAAAGAGAGG + Intergenic
951766067 3:26200649-26200671 CAGAAGGTTGAAAAATAGGCAGG - Intergenic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952166196 3:30751843-30751865 CAGAAGTAGGATTAAATGGCAGG + Intronic
952875575 3:37941711-37941733 GATAAGGAGGAGAAAGAGGGTGG + Intronic
953032638 3:39188355-39188377 CTGAAGGGGGACGAAGAGGCTGG - Exonic
953316000 3:41926511-41926533 CAGAAGTAGGCTAAAGAGGGTGG + Intronic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
954198330 3:49009176-49009198 CAGGAAGAGGCTAGAGAGGCCGG - Intronic
954903918 3:54043677-54043699 AAGAAGGAGGGAAGAGAGGCAGG + Intergenic
955034727 3:55256224-55256246 CCGAAGGATGAGAAAGAGCCAGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955996332 3:64684537-64684559 CAGAAGGAAGACAAAGGGGCAGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956540008 3:70326159-70326181 CAGAAGGAAGGGAAAGAGGAAGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957585297 3:82124832-82124854 AAGCAGGAGCATATAGAGGCAGG + Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958616059 3:96494445-96494467 CAGAGGGAGGACACAGAGGCAGG - Intergenic
959062786 3:101631335-101631357 AAGAAGCAGAATAAAGAGTCTGG + Intergenic
959650608 3:108746991-108747013 CAGAAAGAGGAAAAAGAACCTGG - Intronic
959651806 3:108757618-108757640 GAGAAGGAGAACAAAAAGGCAGG - Intergenic
960710963 3:120527752-120527774 AAGAAGGAGGGAAAAGAGCCAGG + Intergenic
961545717 3:127631436-127631458 CAGAAGGAGGCAAAGGAAGCAGG - Intronic
962607558 3:137045125-137045147 GAGATGTAGGATAAAGAGGAAGG + Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962909350 3:139833741-139833763 GAGAAGGAGGATGAAGAAACGGG - Intergenic
963155543 3:142092151-142092173 GAGAAGGAGGGTAAAGTGGGTGG - Intronic
963274669 3:143318021-143318043 GAGAAGGAAGAAAATGAGGCCGG - Intronic
963544182 3:146633872-146633894 CTGAAGGAGGAGAAAAAAGCTGG - Intergenic
963774477 3:149423981-149424003 CAGATGGAGGGAAAAGAGGGTGG + Intergenic
964276100 3:155010576-155010598 CAGAAGGAAGAAGGAGAGGCTGG - Intergenic
964281298 3:155069258-155069280 CAAATGGAGGACAAAGAGGAGGG + Intronic
964361987 3:155908196-155908218 CAGGAGGAAGATAAAGGGGAGGG + Intronic
964533557 3:157694708-157694730 TAAAAGGAGAATAAATAGGCAGG - Intergenic
964996742 3:162891645-162891667 CAGAAGGGGGCTGAAGTGGCAGG - Intergenic
965871993 3:173275561-173275583 TCCAAGGAGGATAAAGAGGTAGG - Intergenic
966319894 3:178690532-178690554 AAGAAGGAAGAGAAAGAGGGAGG + Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966377579 3:179312631-179312653 AAGAAGAAGAATAAAGATGCAGG - Intergenic
967478027 3:189943296-189943318 CAGAAGGGGACAAAAGAGGCAGG - Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968123659 3:196143297-196143319 GAGAAGGAGGGCAACGAGGCCGG + Intergenic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
969348068 4:6581608-6581630 GAGATGGAGGATAAAGGGCCCGG - Intronic
969836938 4:9850067-9850089 TAGAGGGAGGATACAGATGCTGG + Intronic
971086722 4:23286313-23286335 GAAAAGGAGGAGAAAGAGGAGGG + Intergenic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
971705533 4:30037844-30037866 TAGAAAGATGATAAACAGGCTGG + Intergenic
971729729 4:30361655-30361677 TAGAAGGAGGATACAAATGCTGG - Intergenic
972229463 4:37054568-37054590 GAGAAAGGGAATAAAGAGGCAGG - Intergenic
972412216 4:38806685-38806707 CAGCAGGGGGAAAAAGAGGCAGG - Intronic
973257273 4:48126193-48126215 GAGAAGGATGATGAAGAGGAGGG - Intronic
973270090 4:48254007-48254029 CAATAGGTGGATAAAGAGGGAGG - Intronic
973739092 4:53901926-53901948 GAGAAGGGAGATAAAGAGGAAGG + Intronic
973821481 4:54665512-54665534 CACGAGGAGGATAAAGGTGCAGG + Intronic
973955053 4:56055237-56055259 AAGAAGGAAGATAAGGAGACAGG + Intergenic
973976479 4:56267968-56267990 CACAAGGATGAGAAAAAGGCTGG - Intronic
974316233 4:60284790-60284812 AAGAAGGAGGAAAAAGATGAGGG - Intergenic
974695490 4:65363979-65364001 AAGAGGCAGGATCAAGAGGCAGG - Intronic
975281598 4:72568599-72568621 GAGAAGGAGGAAAGAGAGGAGGG + Intronic
976647817 4:87403412-87403434 CAGAAGGAAAATAAAAAGGCTGG - Intergenic
976948597 4:90800018-90800040 CAGAAGGAAGACACAGAAGCTGG - Intronic
977178749 4:93846722-93846744 CAGGAAGAAGATAAAGAGGAGGG - Intergenic
977386304 4:96343979-96344001 CAGAGGGATGATACAGAGACAGG - Intergenic
978306404 4:107333413-107333435 CAAAAGGAAAATAAAAAGGCTGG + Intergenic
978429182 4:108616045-108616067 AAGAATGAGGATATATAGGCTGG + Intergenic
979096230 4:116554031-116554053 CAGAGGGAGGATATAAGGGCTGG - Intergenic
980114198 4:128663669-128663691 CAGAACGTAGATAATGAGGCTGG - Intergenic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
980576499 4:134688597-134688619 CAGAAGGAGGACACAGACCCAGG - Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
981117104 4:141004439-141004461 CAGAAGAAAAATGAAGAGGCAGG + Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
982363156 4:154545155-154545177 CATAAGGAGGGTAGAGAGCCTGG + Intronic
982464265 4:155710695-155710717 AAGAAGCAGGAAAAAGGGGCAGG + Exonic
982635053 4:157885398-157885420 AAGAAGGAGGGAAAAGAGGGAGG + Intergenic
982909487 4:161121136-161121158 CTGAAGCAGGGAAAAGAGGCTGG + Intergenic
983211404 4:164962138-164962160 AAGAAGGAGGATAAGGAAGGAGG + Intronic
983672455 4:170254171-170254193 AGAAAGGAGGAGAAAGAGGCTGG + Intergenic
983944468 4:173569895-173569917 CAGTAGGAGAATTAAGATGCTGG + Intergenic
984144588 4:176044937-176044959 CAGAAGGAAGATACAGAAGCTGG - Intergenic
984538936 4:181013085-181013107 CAGAAGGAGAATAAAGAGGATGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984772842 4:183453289-183453311 AAGGAGGAGGTTAAAGAGGCAGG + Intergenic
984782389 4:183537708-183537730 GAGGAGGAGGATGAAGAGGAGGG + Intergenic
986285259 5:6354331-6354353 CAGAAGAAGGAAGCAGAGGCTGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986618297 5:9643028-9643050 GAGAGGAAGGATAAAGAGGAAGG - Intronic
986968344 5:13302432-13302454 AAGAAAGATTATAAAGAGGCAGG + Intergenic
987359873 5:17097113-17097135 CTCAAGGTGGATAAATAGGCAGG + Intronic
987428617 5:17803546-17803568 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
987665510 5:20933323-20933345 GAGGACGAGGATAAAGAGGAAGG + Intergenic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988101103 5:26680009-26680031 AAGAAAGAGGAGAAAGAGGGAGG - Intergenic
988164738 5:27572067-27572089 GAGAAGAAAGATAAAGAGGAGGG + Intergenic
988721434 5:33883044-33883066 CACTAGGAGAATAAAGAGGAAGG - Intronic
988757185 5:34268855-34268877 GAGGACGAGGATAAAGAGGAAGG - Intergenic
989167570 5:38446232-38446254 GAGAAGGAGGATACAGCGGCAGG - Intronic
989301861 5:39904129-39904151 CAGAAAGAGGAAAAACTGGCTGG - Intergenic
989748950 5:44867898-44867920 TAGAAAGAGGATATAGAGGCCGG + Intergenic
990654176 5:57936086-57936108 AGGGAGGAGGATACAGAGGCTGG - Intergenic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
991530115 5:67605441-67605463 AAGAAGGTGGATAATGAGGGAGG - Intergenic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
992384076 5:76266899-76266921 CAGAATGAGGATTAACAGTCAGG + Intronic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993302277 5:86225956-86225978 AAGTAGGGGGATAAGGAGGCAGG + Intergenic
993701367 5:91122941-91122963 CAGGAGTAGGAGAAACAGGCAGG - Intronic
993711129 5:91226342-91226364 CAGAAGAAGGAATAAGATGCTGG - Intergenic
994776542 5:104041800-104041822 CAGTATGAGTATAAAGAGACTGG + Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
994858138 5:105152322-105152344 CAGAAGGAGAAGAAAGAGAAAGG - Intergenic
995295336 5:110514478-110514500 AAGAAGGTAGATAAAGAGCCTGG - Intronic
995466063 5:112450436-112450458 AACAAGGAGGTTAAAGATGCAGG - Intergenic
995466786 5:112458163-112458185 CAGAAAGAGAAGAAAGAGACAGG + Intergenic
995820674 5:116227362-116227384 CTGATGGAGAATAAAGAGGCTGG - Intronic
995925687 5:117370349-117370371 CAGAAGGAGAATGAAGAGCAAGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997649966 5:135509649-135509671 TAAAAGGAGGGGAAAGAGGCAGG - Intergenic
998080573 5:139271996-139272018 GAGATGGAGGATAAAGAGAAAGG + Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998739789 5:145187691-145187713 CAGAAGGTGAACAAAGAGCCAGG - Intergenic
998891536 5:146751449-146751471 GAAGAGGAGGCTAAAGAGGCAGG - Intronic
999044842 5:148455924-148455946 GAGGAGGAGGATGAAGAGGGGGG + Intronic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999862641 5:155665122-155665144 CATAAGTAGGATAGAGTGGCTGG + Intergenic
1000578685 5:163008964-163008986 CAGAGGGAGGAGAAAGAGAGTGG - Intergenic
1000776531 5:165426537-165426559 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
1001084169 5:168688299-168688321 CAGAAGGAGGTGACAAAGGCAGG + Intronic
1002913761 6:1511556-1511578 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1003425639 6:5996619-5996641 GAGAACCAGGATAAAGAGGGAGG - Intergenic
1003651756 6:7967313-7967335 CAGAAGGAGGACAAGCAGGTTGG + Intronic
1005111924 6:22291663-22291685 GAGAAGGAGGAGAAAGAGAAAGG - Intronic
1005125779 6:22444822-22444844 CAGAAGGAGAATATAGGGGAAGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG + Intergenic
1006116964 6:31780659-31780681 CAGAAGGAGGAAGGAGTGGCTGG + Intronic
1006430785 6:33994327-33994349 CACAAGGAGAGGAAAGAGGCAGG + Intergenic
1006456086 6:34132872-34132894 AAAAAGGAGGAAAAAGGGGCTGG + Intronic
1006994477 6:38245518-38245540 CAGAGGGAGTATGGAGAGGCAGG + Intronic
1007164771 6:39821579-39821601 GAGAAGGAGGAGACAGAGGTGGG + Intronic
1008124163 6:47649811-47649833 CAGGAGGAGGGTGAAGAGGCAGG + Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1009734954 6:67663764-67663786 CAGAGGGAAGACAAAGATGCTGG - Intergenic
1009798218 6:68499574-68499596 CAGAAATAGAATAAAGAGGAAGG - Intergenic
1010001815 6:70956388-70956410 GGGCAGGAGGATAAAGAAGCGGG + Exonic
1010189055 6:73175933-73175955 ACTAAGGAGGATATAGAGGCTGG + Intronic
1010839034 6:80625420-80625442 CAAAAGGAGGATAAGAAGGAAGG + Intergenic
1010893874 6:81343567-81343589 AACAAGGAGGTTAAAGATGCAGG - Intergenic
1011349598 6:86407995-86408017 AGGAAGGAGTATAAAGAAGCAGG - Intergenic
1011700390 6:89949948-89949970 GAGAGGGAGGAGAAAGAGGGGGG + Intronic
1011934439 6:92757615-92757637 GAGAAGGAGGAGGAAGAGGAAGG + Intergenic
1012130276 6:95482130-95482152 TAGAAGGGGGATAAAGGGGGAGG + Intergenic
1012943151 6:105438497-105438519 AGGAAGGAAGATAATGAGGCTGG - Intergenic
1013124833 6:107172827-107172849 CAGAAATAGGATAGAGTGGCTGG + Intronic
1013329963 6:109090662-109090684 GAGGAGGAGGATCAAGAGGAGGG + Intronic
1013659344 6:112278953-112278975 CTGAAGGAGGACAGAGAGGGAGG + Intergenic
1013680589 6:112521457-112521479 CCCAAGGAGGAGAAAGGGGCTGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014269035 6:119315045-119315067 CAGAAAGAGGAAAGAGAAGCTGG - Intronic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1014717943 6:124887639-124887661 CAGAAGAAGATTCAAGAGGCAGG + Intergenic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1015236600 6:130978339-130978361 CAGAAGGAGGATAGTGAGACAGG - Intronic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015568920 6:134602079-134602101 CAAAAGGAAAATAAAAAGGCTGG - Intergenic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016237449 6:141886257-141886279 CAGAAGGAGGATACACACTCTGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017280694 6:152621123-152621145 CAGAAGGAGATGAAAGAGTCAGG + Intronic
1017659519 6:156660032-156660054 CAGAAGGAGAAAAAAGAGAAAGG + Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019060085 6:169251401-169251423 CTGCAGGAAAATAAAGAGGCAGG - Intronic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1020226994 7:6288317-6288339 AGGAAGGAGGAAAAAGAGGAAGG - Intergenic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1020414417 7:7929605-7929627 CAGAAGGAGGAGTGAGTGGCTGG + Intronic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1021089782 7:16469875-16469897 GAGAAGGAGGAATAAGAGGAAGG - Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021986818 7:26105340-26105362 AAGAAGGAGGATGAGGAAGCTGG - Intergenic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1022657305 7:32331212-32331234 CAGAAGGATCCAAAAGAGGCTGG + Intergenic
1023655928 7:42420831-42420853 GAGAAAGAGGAGAAAGAGGGAGG + Intergenic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1024113662 7:46172449-46172471 CAGATGGAGAGTAAAGAGTCAGG + Intergenic
1024234948 7:47390929-47390951 CAGAAAGATAACAAAGAGGCTGG - Intronic
1024691591 7:51808947-51808969 AAAAAGGAAGAAAAAGAGGCAGG - Intergenic
1024822286 7:53346718-53346740 GAGAAGGAGGATGAGGAGGAGGG - Intergenic
1024919255 7:54540935-54540957 TACAAGGAGGATACAGAGTCTGG + Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1025861979 7:65338847-65338869 CAGAGGGAGGACACAGATGCTGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026905076 7:74058169-74058191 CAGGAGGAGGAGGAAGAGGGAGG - Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027554727 7:79648674-79648696 CAGAGGGAGGATGAAGATGCTGG - Intergenic
1027743419 7:82041236-82041258 GAGAAGGAAGAAAAAGATGCAGG + Intronic
1027784686 7:82566105-82566127 AAGAAAGAGGAGAAAGTGGCCGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028170641 7:87591399-87591421 AAGAGGGATGATAAAGAGGCAGG + Intronic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029873607 7:103723234-103723256 GAGAAAGAGGAGAAAGATGCTGG + Intronic
1030636668 7:111957341-111957363 CAAAAGGATGATAAAGAAACTGG + Intronic
1031023270 7:116651288-116651310 GAAAAGGAAGATAAAGAAGCAGG + Intergenic
1031329949 7:120452484-120452506 CAGAGGGAGGATACAGACACTGG + Intronic
1031537419 7:122952447-122952469 GAGAAGGAGGAAGGAGAGGCAGG + Intergenic
1031630200 7:124034478-124034500 GGGAAGGAGGAGAAAGAGGGAGG - Intergenic
1031789444 7:126082533-126082555 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1031794157 7:126150115-126150137 GGGAAGGAGGAGAAAGAGGGAGG + Intergenic
1032123392 7:129173083-129173105 CAGAGGGAAGATGAAGAGGGAGG - Intergenic
1032214918 7:129950549-129950571 AAGATTGAGGATAAAGAGGGGGG - Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1033019419 7:137707615-137707637 CAGGAGGAAGAAAAAGAGGGTGG - Intronic
1033065572 7:138150619-138150641 GAGAAGGAGGAGGAAGAGGAAGG + Intergenic
1033156923 7:138965067-138965089 CTGAAGGAGGCTGAAGAGGGAGG - Intronic
1033255536 7:139798222-139798244 CAGAAGGAAAAGAAAGAAGCCGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033395947 7:140973835-140973857 CAGAAGCAGGATAAAGACAAGGG - Intergenic
1033610832 7:142961889-142961911 GAGAAGGAGGAGAGAGAAGCTGG + Intronic
1034227831 7:149497208-149497230 CAGAAGGAGGGGACAGCGGCTGG + Intronic
1034457494 7:151178967-151178989 GGGAAGGAGGAGGAAGAGGCAGG - Intronic
1034944201 7:155251370-155251392 CAAAAGGAGGGTGAAGAAGCTGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1035945518 8:3957129-3957151 AAGTAGGGGGAGAAAGAGGCAGG - Intronic
1036335815 8:7869032-7869054 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1036504486 8:9342869-9342891 CAAAAGGAGGATAATGAAGTAGG + Intergenic
1036725123 8:11213472-11213494 CAGGAGCTGGATACAGAGGCAGG - Intergenic
1037946106 8:22990604-22990626 CAGAAGGAGGAGGAAGAGGGTGG + Intronic
1037980128 8:23247141-23247163 AAGAAGGAAAATAAGGAGGCTGG + Intronic
1038067122 8:23974777-23974799 GAAAAGGAGGAGAAAGAGGGAGG + Intergenic
1038139484 8:24827687-24827709 GAGAAGGAGGACAAGGAAGCTGG + Intergenic
1038169441 8:25115721-25115743 TAGAAGGAGGAGGCAGAGGCCGG + Intergenic
1038170538 8:25127943-25127965 CAGAAGGAAGACACAGAAGCTGG + Intergenic
1038483602 8:27918599-27918621 GAGAAGGAGGAGGAAGAGGAGGG + Intronic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1039622363 8:39010033-39010055 AAGAAGGGGGATAGGGAGGCTGG + Intronic
1039785362 8:40829979-40830001 TAGATGGAAGAAAAAGAGGCTGG + Intronic
1039883610 8:41642720-41642742 CAGAAAGTAGACAAAGAGGCCGG - Intergenic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041439689 8:57881421-57881443 GAGAAGGAGGAAGAAGAGGAGGG - Intergenic
1041858133 8:62481298-62481320 CAAATGGAGGATGAAGAGGGTGG - Intronic
1042426871 8:68659355-68659377 CAGAAGGAGGCAAAAGAGGCTGG - Intronic
1042711493 8:71722490-71722512 GAGAAGTTGGATAAAGATGCAGG - Intergenic
1042749222 8:72139948-72139970 CAGGAGGAGGAGAAAGAGTGGGG - Intergenic
1043153506 8:76747983-76748005 CAGAAGGAAGATACAGAAACAGG - Intronic
1043185078 8:77138158-77138180 CAGAAGGAAGACAGAGGGGCAGG - Intergenic
1044157141 8:88861471-88861493 CAGAGAGAGGATAAAGGGACGGG - Intergenic
1044675137 8:94720450-94720472 CACCACGGGGATAAAGAGGCAGG + Intronic
1044800168 8:95945590-95945612 CAGAAGAGGGATGAACAGGCCGG - Intergenic
1044972419 8:97632987-97633009 CAGAAGTGGGATAAAGTGGAGGG - Intergenic
1045132316 8:99166974-99166996 GAGAAGGAGGAAATAGAGGAAGG + Intronic
1045182320 8:99797638-99797660 CATAAGGAGGCCAAAGGGGCAGG - Intronic
1045713870 8:105018834-105018856 CAGAAGGAGGAAAAAATGTCAGG - Intronic
1045816486 8:106282722-106282744 GAGAAGGAGGAGAAAGAAGAGGG + Intronic
1045865174 8:106857217-106857239 CAGAAGGAGTAGGAAGAGGTGGG - Intergenic
1045887245 8:107113239-107113261 CAGAAGGAAGAAAAAGAGGTGGG + Intergenic
1046054372 8:109061408-109061430 CTGAAGGAGGATCCAGAGGAAGG + Intergenic
1046096927 8:109573600-109573622 CAAAGGGAGGATAAAGAGGCTGG - Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046359040 8:113126663-113126685 CAGAAGGAGGAGGAAGGGGAAGG + Intronic
1047441330 8:124880980-124881002 CAGAATGAAGATTAAGAGGGTGG - Intergenic
1047455617 8:125007455-125007477 CAGTACAAGGATAAAGAGACTGG + Exonic
1048727177 8:137400130-137400152 CAGAGGGAGGACAAAGATGCTGG + Intergenic
1048755908 8:137737961-137737983 GAGAAGGAAGAAAGAGAGGCAGG + Intergenic
1048821288 8:138382939-138382961 CAGAAGATGGATAGAGAGGATGG + Intronic
1049495186 8:142926900-142926922 CAGAAGGAGGAGACGGATGCAGG - Intergenic
1050424722 9:5501562-5501584 CAGAGGGAAGACACAGAGGCTGG + Intergenic
1050831170 9:10015710-10015732 CAGAAAGAAGAGAAAGAGGTGGG + Intronic
1051014209 9:12455832-12455854 CAGAAGGAGGAAATGGATGCTGG + Intergenic
1051284909 9:15486005-15486027 CAGAAGGGGGAGAAAGAGAAAGG - Exonic
1051339499 9:16098458-16098480 CAGAAGGAGAATAAGAAAGCTGG + Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1052122242 9:24731587-24731609 CAGAAGGAGTTGATAGAGGCAGG - Intergenic
1052142599 9:25004842-25004864 CAGAGGGAAGATACAGAAGCTGG - Intergenic
1052900648 9:33791921-33791943 CAGAAGGAGGGGCAAGGGGCAGG + Intronic
1053466813 9:38314616-38314638 AAGAAGGAGGGGAAAGAGGGAGG - Intergenic
1053904440 9:42826761-42826783 GACAAGGAGGAGAAAGAGGGTGG + Intergenic
1054530545 9:66178753-66178775 GACAAGGAGGAGAAAGAGGGTGG - Intergenic
1055754514 9:79543406-79543428 CAGTTGGAGAATACAGAGGCAGG + Intergenic
1056454952 9:86751161-86751183 GAGGAGGAGGATACAGAGGCTGG + Intergenic
1056523338 9:87420300-87420322 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1056796600 9:89662935-89662957 CAGAAGCAAGACAAAGAGGAGGG - Intergenic
1057477113 9:95412124-95412146 GTGAAGGAAGAGAAAGAGGCAGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058014036 9:100009800-100009822 GAGAAGGAGGTTAGAGAGGAGGG - Intronic
1058268980 9:102945346-102945368 CAGAAGGAGAAGAAAGGAGCAGG - Intergenic
1058845196 9:108950582-108950604 TAGAAGGAGGATTAAGAGTGGGG - Intronic
1059455396 9:114397401-114397423 CAGAAGGAGAAGAAATGGGCTGG - Intergenic
1059568339 9:115406934-115406956 CCCAAGGAGGATAGAGAGCCTGG + Intergenic
1059578590 9:115519183-115519205 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1059954412 9:119500728-119500750 TAGAAGGAGGCCAGAGAGGCAGG - Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060443312 9:123662271-123662293 CAAAAGAAGAATAAAGAGGCTGG + Intronic
1060630214 9:125150933-125150955 CAGCAGGATAATAAAGAGTCAGG + Intronic
1185665568 X:1762736-1762758 CAAAAAGAAGAAAAAGAGGCCGG - Intergenic
1185975882 X:4719577-4719599 CAGAAGAAAGGTAAAGGGGCAGG - Intergenic
1186120395 X:6354903-6354925 GAAAAGGAGGAAAAATAGGCCGG - Intergenic
1186125547 X:6409943-6409965 CATGAGGAGGAGAAAGAGGTAGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186821808 X:13296489-13296511 CAGAAGAAAGACAAAGAAGCAGG - Intergenic
1186827625 X:13356921-13356943 TAGAAGAAGTATTAAGAGGCAGG + Intergenic
1187025680 X:15433636-15433658 AAGAAGGAGGAAGAAGAGGAAGG + Intronic
1187025794 X:15434156-15434178 AAGAAGGAGGAGAAAGAAGAAGG + Intronic
1188260660 X:28019190-28019212 CAGGAGGAAGAGAAAGAGGGTGG + Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190385782 X:49881007-49881029 CAGAAGGAGGTGCAAGAGCCAGG - Exonic
1190435202 X:50417669-50417691 CAGAATGAGGATAGAAAGGGAGG - Intronic
1190483939 X:50905405-50905427 CAGAAGGGGGATAACGAAGGAGG + Intergenic
1190732025 X:53232850-53232872 CAGAAGTAGGAGGCAGAGGCAGG + Intergenic
1191108382 X:56786603-56786625 GAGAAGGAGGAGAAAGAAGAAGG - Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192583441 X:72302883-72302905 CAGAAGTTGGATAAATTGGCGGG + Exonic
1192592955 X:72376202-72376224 AAAAAGGAGTATAAAGAGCCAGG - Intronic
1193036706 X:76958619-76958641 CAGAGGGAGGACACAGATGCTGG - Intergenic
1193221949 X:78935923-78935945 CAGAGGGAAGATACAGAAGCTGG - Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193514930 X:82451768-82451790 CAGAAGGAGGACACAGATGATGG + Intergenic
1193851506 X:86543139-86543161 AAGAATGAGGACACAGAGGCAGG + Intronic
1194033505 X:88843494-88843516 CAAAAGGAAAATAAAAAGGCTGG - Intergenic
1194857510 X:98952051-98952073 TAGAAGGATGGTTAAGAGGCTGG - Intergenic
1195405262 X:104505664-104505686 CTTAAGGAGGATAAAGAAGCAGG - Intergenic
1195514834 X:105762115-105762137 CTGAAGGAGGAAATAGAAGCAGG - Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196663809 X:118295406-118295428 CAAAAGGAAAATAAAAAGGCTGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197101868 X:122665523-122665545 CAAAATGAGGTTAAAGAGGTAGG - Intergenic
1197241240 X:124125277-124125299 CTACAGGAGGGTAAAGAGGCTGG - Intronic
1197809312 X:130427412-130427434 CAGAAGGAGACAAAATAGGCTGG + Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1198039926 X:132840441-132840463 GAGAGGGAGGATGAAGAGGAAGG - Intronic
1198204188 X:134450876-134450898 CAGAAGGAGGATCAGGAAGGTGG + Intergenic
1198344458 X:135746180-135746202 CAAAAGGAAAATAAAAAGGCTGG + Intergenic
1199128285 X:144152216-144152238 GAAAAGGAAGATAAAGGGGCAGG + Intergenic
1199250912 X:145660419-145660441 CAGGAGGAAGAGAAAAAGGCGGG - Intergenic
1199778195 X:151034059-151034081 GAGAAGGAGGAAGAAGAGGAAGG + Intergenic
1199939935 X:152615216-152615238 GAAAATGAGGGTAAAGAGGCAGG + Intergenic
1200827590 Y:7660084-7660106 CAGAAGGAGGAGGAAAAGGTTGG + Intergenic
1201453028 Y:14136429-14136451 GAGAAGGAGGATACAGAGCAGGG - Intergenic
1201897149 Y:19004029-19004051 CAGCAGGAAGACAAAGAGGGTGG + Intergenic