ID: 928915976

View in Genome Browser
Species Human (GRCh38)
Location 2:36470931-36470953
Sequence CAGAATATTAACATGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928915968_928915976 23 Left 928915968 2:36470885-36470907 CCATTCTAGATGCCATTAAGAAC 0: 247
1: 521
2: 557
3: 441
4: 366
Right 928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG 0: 1
1: 1
2: 0
3: 23
4: 317
928915970_928915976 11 Left 928915970 2:36470897-36470919 CCATTAAGAACACAGGTGATTCA 0: 1
1: 4
2: 37
3: 309
4: 735
Right 928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG 0: 1
1: 1
2: 0
3: 23
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928915976 Original CRISPR CAGAATATTAACATGGAGTT TGG Intronic
905336971 1:37251443-37251465 AAGAAAATTAAGCTGGAGTTTGG + Intergenic
905950353 1:41945654-41945676 CAGAATCAGAACATGGAGATTGG + Intronic
906507334 1:46389961-46389983 CAGAATCAGAACATGGAGATTGG - Intergenic
907602565 1:55785624-55785646 CAGAATCAGAACATGGAGATTGG - Intergenic
907830898 1:58063244-58063266 CAGAATGTTAAAATGGCCTTGGG + Intronic
909041633 1:70660124-70660146 CTGAATATTGACATTGACTTTGG - Intergenic
909102550 1:71367565-71367587 CCTAATATAAATATGGAGTTTGG - Intergenic
909135088 1:71788063-71788085 CAGAATATTAACATGAATCATGG - Intronic
909224724 1:73004940-73004962 AAAAATATTAACATGTACTTCGG - Intergenic
909629093 1:77752033-77752055 CAGAATTTCAACCTGGAATTTGG - Intronic
909929031 1:81473660-81473682 CACAATATTAACCTGGAGACGGG - Intronic
910590998 1:88928014-88928036 CAGAATCAGAACATGGAGATTGG + Intergenic
913599757 1:120412000-120412022 CAGAATCCTAACAGGGAGATGGG + Intergenic
914591112 1:149106557-149106579 CAGAATCCTAACAGGGAGATGGG - Intergenic
916709296 1:167388755-167388777 CAGAAAATTAATTTGGATTTTGG + Intronic
919356344 1:196527386-196527408 CATCATACTAACATGAAGTTAGG + Intronic
920274917 1:204797514-204797536 CGGAATACTAACATGGAGGAAGG - Intergenic
920425246 1:205869838-205869860 CAGAATCAGAACATGGAGATTGG - Intergenic
922219661 1:223548865-223548887 CAGAATCTTAACATGGCTTGTGG - Intronic
922684724 1:227630313-227630335 CAGAATCAGAACATGGAGATTGG - Intronic
924474417 1:244370766-244370788 CAGAATAGCGACATGGAGTTTGG + Intronic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
1062898213 10:1121219-1121241 CATTTCATTAACATGGAGTTAGG + Intronic
1063772640 10:9221826-9221848 AAGAACATAAACTTGGAGTTTGG + Intergenic
1064197985 10:13260907-13260929 CAGTATATTCACATTGTGTTGGG + Intergenic
1065199647 10:23300743-23300765 CAGAATCAGAACATGGAGATTGG - Intronic
1065673678 10:28151109-28151131 CAGACTTTTACAATGGAGTTTGG - Intronic
1067254071 10:44618013-44618035 TAAAATTTTAACATGAAGTTTGG + Intergenic
1071219882 10:83453328-83453350 CAGAGTGTTATCATGGTGTTTGG + Intergenic
1071327047 10:84528001-84528023 CAGAATTAGAACATGGAGATTGG - Intergenic
1071384956 10:85110495-85110517 AAGAATATAAAGATGGTGTTAGG + Intergenic
1071905288 10:90166841-90166863 TAAAATAGTAAAATGGAGTTAGG - Intergenic
1071990369 10:91095570-91095592 CAGAGTAATAAGATGAAGTTTGG + Intergenic
1072378111 10:94838195-94838217 CAGAATCAGAACATGGAGATTGG - Intronic
1072471959 10:95721281-95721303 CAGAATCAGAACATGGAGATTGG - Intronic
1073742090 10:106419116-106419138 GAGAATAATAAAATGGACTTTGG + Intergenic
1078292673 11:10028888-10028910 CAGAATATTAAATGTGAGTTTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078767182 11:14309779-14309801 CAGAAAATTAACAGGGAGGCAGG + Intronic
1079601355 11:22316003-22316025 CAGAATCAGAACATGGAGATTGG - Intergenic
1080096665 11:28416483-28416505 CAGAACCTTTACATGGAGTGAGG - Intergenic
1080910903 11:36597496-36597518 AAGAATGTTAGCATGGGGTTGGG - Intronic
1080975985 11:37341049-37341071 AAGTATATTAACATGGAGGAGGG - Intergenic
1081070536 11:38604586-38604608 CAGAATCAGAACATGGAGATTGG + Intergenic
1081376259 11:42362261-42362283 TAGAATTTTAACATGAATTTAGG - Intergenic
1081410229 11:42749110-42749132 CACAAAAGTAACATGGATTTAGG - Intergenic
1084018880 11:66405170-66405192 CAGGATATCAAGATGGAATTGGG + Intergenic
1084564832 11:69922750-69922772 CAGCATATGAACATGGGGCTTGG - Intergenic
1086365362 11:86104488-86104510 CAGCATATTAAAATGAAGCTAGG + Intergenic
1086521584 11:87674358-87674380 GAGGATATGAACATGGAGTTTGG + Intergenic
1089237618 11:117045510-117045532 CAGAATATTAAAATGGCTTATGG - Intronic
1090757829 11:129809674-129809696 CAGAATGATACCATGGACTTTGG + Intergenic
1092294041 12:7184039-7184061 CAGAATCAGAACATGGAGATTGG + Intergenic
1092469490 12:8765301-8765323 CAGAATCAGAACATGGAGATTGG - Intronic
1093278936 12:17166761-17166783 CAGAATATTACCATGATATTTGG - Intergenic
1093869268 12:24267297-24267319 CAAAATATAAACATGATGTTTGG - Intergenic
1095138935 12:38639323-38639345 CAGAATCAGAACATGGAGATTGG + Intergenic
1095283889 12:40387103-40387125 CAGAATCAGAACATGGAGATTGG + Intergenic
1096344794 12:50836411-50836433 AAGAATGATAAAATGGAGTTTGG + Intergenic
1096352108 12:50909103-50909125 CAGAATCAGAACATGGAGATTGG - Intergenic
1097149698 12:56967577-56967599 CAGAATCAGAACATGGAGATTGG - Intergenic
1097377302 12:58856170-58856192 CAGAATCAGAACATGGAGATTGG - Intergenic
1098181390 12:67850281-67850303 TAGTATGTGAACATGGAGTTTGG - Intergenic
1098476891 12:70915346-70915368 CAGAATTTTTACAAGGTGTTAGG + Intronic
1101578245 12:106017821-106017843 CAGAAAATAAACACAGAGTTGGG - Intergenic
1103803012 12:123551710-123551732 CAGAATCAGAACATGGAGATTGG + Intergenic
1104851584 12:131877814-131877836 CAGAATGAGAACATGGAGATTGG - Intergenic
1105378981 13:19869345-19869367 TGAAATATTAACATGGAGTATGG + Intergenic
1105673437 13:22644584-22644606 CAGAACAACAACGTGGAGTTTGG - Intergenic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1108611972 13:52093043-52093065 CACAATATTACCATTGACTTGGG + Exonic
1108736049 13:53284254-53284276 CAGAAATCTAAAATGGAGTTGGG - Intergenic
1108876643 13:55057196-55057218 CAGAATCAGAACATGGAGATTGG + Intergenic
1109931715 13:69225045-69225067 CAGAATCAGAACATGGAGATTGG + Intergenic
1110286955 13:73760895-73760917 TAGAATATGAACATGGATTCTGG + Intronic
1111078290 13:83267669-83267691 GAGTATATTAACAGAGAGTTGGG - Intergenic
1112451277 13:99512628-99512650 CAGAAGATTAACATGGTTTCTGG + Intronic
1113256127 13:108508001-108508023 GAGAATATTAACAAAGAGATAGG - Intergenic
1113514605 13:110884103-110884125 CTGAATTTGAAAATGGAGTTTGG - Intronic
1114134838 14:19835312-19835334 CAGAATTAAAACATGCAGTTGGG + Intergenic
1114906574 14:27135584-27135606 CAGAATGTTATAATGGATTTTGG + Intergenic
1114977429 14:28119297-28119319 CAAAATATCAACCAGGAGTTGGG + Intergenic
1115574008 14:34693516-34693538 CAGCAGAATAACGTGGAGTTTGG + Intergenic
1115788446 14:36853079-36853101 CAGAATATTACTAAGGAATTTGG + Intronic
1116669712 14:47825286-47825308 TAGACTAATAACATGGATTTTGG - Intergenic
1116934058 14:50719352-50719374 CAGCATATTAACATGGTTTTAGG + Intergenic
1118410633 14:65474109-65474131 CAGAATAGTAAAATAGACTTTGG + Intronic
1120345300 14:83281335-83281357 CAGAATAATAACATAGAGGAGGG - Intergenic
1121511840 14:94518404-94518426 AAGAATGTGAACATCGAGTTAGG + Intergenic
1122253527 14:100459481-100459503 CAAAATATAAATTTGGAGTTGGG - Intronic
1122338825 14:101011593-101011615 CAGAATATTAGGGTGGAGTTGGG - Intergenic
1202928924 14_KI270725v1_random:22291-22313 CAGAATATTGACATATAATTAGG - Intergenic
1124008663 15:25815914-25815936 TAGATTATTAGCATAGAGTTAGG - Intronic
1124477343 15:30045914-30045936 CAGAATATTTACATAAAGCTGGG - Intergenic
1124545064 15:30619078-30619100 CATAAGATTATAATGGAGTTGGG - Intergenic
1124778587 15:32608467-32608489 CATAAGATTATAATGGAGTTGGG - Intergenic
1125284242 15:38074678-38074700 CACAATCTTAAAATGGAGATAGG + Intergenic
1125483092 15:40093744-40093766 CATAATAGTAACGTGGGGTTAGG + Intronic
1127690016 15:61386256-61386278 TAGAATTTTAACATAGAGGTGGG - Intergenic
1129506050 15:76082474-76082496 CAGAGTATTATGATGGAGTCAGG + Intronic
1130335024 15:82951397-82951419 CAGAAACTTAACCTGGAGTACGG + Intronic
1130603599 15:85295353-85295375 CAGAATGTTGGCATGGAGTGGGG - Intergenic
1130700257 15:86172007-86172029 AAGAATGTTAAAATGGACTTTGG + Intronic
1134900610 16:17934519-17934541 CAGAAAATTAAAATGGTTTTAGG + Intergenic
1135224701 16:20645743-20645765 CAGAATCAGAACATGGAGATTGG + Intronic
1137492208 16:48942762-48942784 GACAATATAAACTTGGAGTTAGG - Intergenic
1139046273 16:63063400-63063422 TAAATTATTAACATGAAGTTGGG - Intergenic
1140326605 16:74010279-74010301 CATAAGATTATAATGGAGTTTGG + Intergenic
1143197984 17:5091060-5091082 CATAATATTAACGGTGAGTTGGG - Intronic
1144968914 17:19094792-19094814 CACAATGTTATCATGGAGCTGGG - Intronic
1144979002 17:19157274-19157296 CACAATGTTATCATGGAGCTGGG + Intronic
1144989220 17:19220958-19220980 CACAATGTTATCATGGAGCTGGG - Intronic
1145396043 17:22495810-22495832 GAGAATATTAACAAAGAGATGGG + Intergenic
1146917782 17:36689193-36689215 GAAAATATTAATTTGGAGTTGGG + Intergenic
1149274126 17:55015279-55015301 CAGAATCAGAACATGGAGATTGG - Intronic
1152078510 17:78172555-78172577 CAGAATATTTACATAAAGCTGGG - Exonic
1153401506 18:4688157-4688179 CAGAATCAGAACATGGAGATTGG + Intergenic
1153811477 18:8755726-8755748 CAGAATGTTCACAGGGAGTGGGG + Intronic
1156681093 18:39589773-39589795 CAGGATATCAACAGGGAGTTTGG + Intergenic
1159409307 18:68050716-68050738 AAGAATAATAAAATGGATTTTGG - Intergenic
1159718210 18:71851297-71851319 CAGAAAAATAAAATGGAGATGGG - Intergenic
1159829874 18:73263562-73263584 CTGAAGATTAACATCTAGTTTGG - Intronic
1165530368 19:36394791-36394813 GAGAATAGCAACATGGATTTAGG - Intronic
1166399978 19:42471451-42471473 CAGAATGTTAACAAGGATTGAGG + Intergenic
924960359 2:29261-29283 AAGGATAGAAACATGGAGTTGGG + Intergenic
925659381 2:6186128-6186150 CAGAATATTAAAATTGAATAAGG + Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
928677013 2:33660283-33660305 CAGAATCAGAACATGGAGATTGG + Intergenic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
929583054 2:43096169-43096191 CAGTACAGTAACATGGAGTATGG + Intergenic
929625188 2:43399506-43399528 CAGAATTTCATCATGGTGTTGGG + Intronic
930233913 2:48870971-48870993 CAGAAAGTTAACATGGAGGGAGG + Intergenic
930902344 2:56522665-56522687 TTGAATATTAACAAGTAGTTTGG + Intergenic
932662804 2:73671551-73671573 CAGAAGATTAAAATGAATTTAGG + Intergenic
932798561 2:74719012-74719034 CAGAATATTAACATATACTAGGG + Intergenic
932917633 2:75875184-75875206 CAGAATCAGAACATGGAGATTGG + Intergenic
933556906 2:83841986-83842008 CAGCATATAGACATGCAGTTGGG - Intergenic
934853229 2:97714065-97714087 CAGAATATTAACTGGGAGTCAGG + Intronic
935158508 2:100507273-100507295 CAGAATATCAACAAGGATATAGG + Intergenic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
936051746 2:109229135-109229157 CAGAAAATTACCAGGGATTTAGG + Intronic
936387341 2:112042010-112042032 CAGAATCAGAACATGGAGATTGG - Intergenic
936953444 2:118001382-118001404 CAGAATATTAACATGAAACATGG + Intronic
937712550 2:124995071-124995093 AAGAATTTAAACATGGAGTTTGG + Intergenic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939119599 2:138100522-138100544 TAGAATTTTAACATGAATTTGGG + Intergenic
940983896 2:160033786-160033808 CAGAAAATTAAGACTGAGTTTGG + Intronic
941159044 2:162014882-162014904 CAGAATTCTAAAATAGAGTTGGG - Intronic
941462348 2:165786553-165786575 CACAATATTTACATTGAATTAGG - Intronic
942580457 2:177411439-177411461 CAGAATCAGAACATGGAGATTGG - Intronic
942830766 2:180235777-180235799 CAGAATCAGAACATGGAGATTGG + Intergenic
943094281 2:183410003-183410025 CAGAACATTAACAGGGAGGTTGG - Intergenic
943868614 2:192962302-192962324 CAAAATATTAAGATGCACTTGGG + Intergenic
945371802 2:209027758-209027780 CAGTATATTAACATAGACATAGG - Intergenic
945927675 2:215821929-215821951 CAGAAAATTAACAAGGATTCAGG + Intergenic
947106307 2:226671399-226671421 CAGAATATTAACAAGCAGGTGGG + Intergenic
947282075 2:228466462-228466484 CAAAACTTTAACATGGAGTGGGG + Intergenic
947934571 2:233992930-233992952 CAGAATATAAACATTGTTTTAGG + Intronic
1170005848 20:11668070-11668092 CAGAATATTGACATTGAGGAGGG + Intergenic
1172263017 20:33585096-33585118 CAAAATTTTAACAGGTAGTTTGG - Intronic
1172992298 20:39045576-39045598 CAGAATATGAGCTTGGAGGTGGG - Intergenic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1175287679 20:57848392-57848414 CAAAATATTGACATGGAGAATGG - Intergenic
1176004742 20:62854659-62854681 CAGAATATTAACAGAGTGTTGGG - Intronic
1176590946 21:8650878-8650900 CAGAATATTGACATATAATTAGG - Intergenic
1177205670 21:18007880-18007902 TAGAATCTTAATATGGAGTTTGG + Intronic
1177965608 21:27722714-27722736 CAGAATGTTAAAATGAAGTAAGG + Intergenic
1178080619 21:29060274-29060296 TATAATACTAACATGGAATTTGG - Intronic
1179259164 21:39743144-39743166 CAGAATCAGAACATGGAGATTGG - Intergenic
1180273774 22:10627911-10627933 CAGAATATTGACATATAATTAGG - Intergenic
1180742528 22:18063929-18063951 GAGAATATCAACATTCAGTTAGG - Intergenic
1181825686 22:25513707-25513729 CAGATCTTTACCATGGAGTTTGG + Intergenic
1182230915 22:28836950-28836972 AAGAAAATAAAGATGGAGTTGGG - Intergenic
1182679671 22:32068852-32068874 TAGAAGATTAAAAGGGAGTTAGG + Intronic
1183984983 22:41564561-41564583 CAGATTATTAAAATGCAGCTTGG - Intronic
949136319 3:570807-570829 CAGAATATTGACATATAATTAGG + Intergenic
951200717 3:19873296-19873318 CAGAATCAGAACATGGAGATTGG - Intergenic
951350315 3:21599549-21599571 CATAGTATAAACATGGAGTTTGG + Intronic
951837837 3:27002407-27002429 CAGAATCGGAACATGGAGATTGG + Intergenic
951956192 3:28256894-28256916 CAGAATATTAAAATTGAGAGAGG + Intronic
952227783 3:31396551-31396573 CAGAATATTACCTTGGAAGTAGG + Intergenic
952710188 3:36423313-36423335 AAGAAAATTAAAATGGATTTTGG + Intronic
955034346 3:55251734-55251756 CAGAATGTTCACATGGGGTCTGG - Intergenic
955136239 3:56221574-56221596 CAGGATGTTTACATGGAGGTAGG - Intronic
956778598 3:72587070-72587092 CAGCACAACAACATGGAGTTTGG + Intergenic
957516295 3:81256889-81256911 CATAATAATAACATGCATTTAGG + Intergenic
958016294 3:87943103-87943125 CAGAATCAGAACATGGAGATTGG - Intergenic
958629834 3:96671147-96671169 CAGAATCAGAACATGGAGATAGG - Intergenic
958767957 3:98393822-98393844 CAGAACATTAAGATGCTGTTAGG + Intergenic
959394829 3:105824154-105824176 CAGCTTATAAACCTGGAGTTTGG - Intronic
959412361 3:106040509-106040531 TAGAAAATTAACATAGATTTTGG - Intergenic
959911573 3:111769332-111769354 GAGAATATTTACTTGGACTTTGG - Intronic
960673104 3:120170728-120170750 GATACTATAAACATGGAGTTGGG + Intronic
961348676 3:126283590-126283612 CAGTATAGTAACATGCAGTATGG - Intergenic
962174687 3:133140772-133140794 CAGAAAATTAAAATGAAGTCTGG + Intronic
962381626 3:134902980-134903002 CAGATAATGAACATGGAGTTAGG + Intronic
963187915 3:142439377-142439399 CAGAATCAGAACATGGAGATTGG + Intronic
964461854 3:156940647-156940669 AACATTACTAACATGGAGTTAGG - Intronic
964717548 3:159738461-159738483 GTGAATATTAACATGGAGAGAGG - Intronic
965006452 3:163032435-163032457 CAGTACATAAACATGGATTTAGG + Intergenic
965054827 3:163698800-163698822 CAGAATCAGAACATGGAGATTGG - Intergenic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
966353466 3:179055946-179055968 CAGAATCAGAACATGGAGATTGG + Intronic
967623531 3:191661709-191661731 CAGAATCAGAACATGGAGATTGG + Intergenic
968391209 4:194416-194438 CAGAATCAGAACATGGAGATTGG - Intergenic
970447176 4:16134101-16134123 TAGAATTTCAACATGTAGTTTGG - Intergenic
972243351 4:37218086-37218108 GAGAATATTAACAAGGAGTCTGG - Intergenic
972370385 4:38418258-38418280 CAGAATATTTACATGTAGTAAGG - Intergenic
972781378 4:42289656-42289678 CAGAATCAGAACATGGAGATTGG - Intergenic
974520435 4:62975129-62975151 CAGAATCAGAACATGGAGATTGG + Intergenic
975313849 4:72930413-72930435 CAGAATCAGAACATGGAGATTGG - Intergenic
976189810 4:82477136-82477158 CAGAATCAGAACATGGAGATTGG + Intergenic
976464745 4:85354489-85354511 CAGAATCAGAACATGGAGATTGG - Intergenic
977298475 4:95238474-95238496 GACAATATTAACATGGAATATGG - Intronic
978305615 4:107324758-107324780 CATAATATTTACATTGTGTTAGG - Intergenic
978382762 4:108147203-108147225 AAAAATACTGACATGGAGTTAGG - Intronic
978586835 4:110283074-110283096 CAGAATCAGAACATGGAGATTGG - Intergenic
978759430 4:112339999-112340021 CAGAATGGTAACTTGGATTTCGG + Intronic
978914937 4:114113034-114113056 AGAAATATTAACATGGAATTAGG + Intergenic
978994165 4:115129754-115129776 CGGCATATGAACATGGAGATAGG - Intergenic
981030809 4:140123788-140123810 CTGAATAATAAAATGAAGTTGGG + Intronic
984986210 4:185332261-185332283 CAGAATATTCAGGTTGAGTTGGG + Intronic
985936724 5:3103105-3103127 AAGGAAATTAACATGGAATTAGG + Intergenic
986231256 5:5866621-5866643 CAGGATCTTAACATCCAGTTGGG + Intergenic
988848971 5:35159693-35159715 CATGATCTTAGCATGGAGTTTGG + Intronic
989689771 5:44127302-44127324 AAGAATAATACCATGGACTTTGG + Intergenic
990892216 5:60661838-60661860 CAGAATCAGAACATGGAGATTGG + Intronic
991204032 5:64029595-64029617 CAGATTATTAAAGTGAAGTTTGG - Intergenic
991547671 5:67801388-67801410 GAGAATAGTAACATGGGCTTTGG + Intergenic
993214603 5:85003817-85003839 AAGAAGATTAACATCTAGTTCGG + Intergenic
993914119 5:93720924-93720946 CAGAATATACACATGAAGGTGGG - Intronic
994117484 5:96077518-96077540 CACAATTTCAACATGAAGTTTGG - Intergenic
995465612 5:112447170-112447192 CAGAATCAGAACATGGAGATTGG + Intergenic
995853493 5:116571572-116571594 CAAAATAATAACAGGGAGTAAGG + Intronic
995987422 5:118195500-118195522 CAGATTATTAAAATAGAGTTGGG + Intergenic
996096673 5:119406637-119406659 CAGAATGTTAAGACGGAATTTGG - Intergenic
996187358 5:120493592-120493614 CAGAATATTGACATTGATATAGG + Intronic
996689059 5:126318073-126318095 CTGAATATGAAGGTGGAGTTGGG - Intergenic
998145210 5:139723879-139723901 AAGAATATCAACATGGAGTCTGG - Intergenic
998804986 5:145909627-145909649 CAGAATATAAGCATGGACTTTGG + Intergenic
999297203 5:150467162-150467184 TAGGATTTTAACATGGATTTAGG - Intergenic
1000164419 5:158634032-158634054 GAGAATATTAACCTGAAGGTGGG - Intergenic
1000478428 5:161742260-161742282 GAGTGTATTAACATGGACTTTGG - Intergenic
1000764245 5:165266004-165266026 GAGAATATTCATCTGGAGTTGGG + Intergenic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1001184111 5:169551076-169551098 CTGAAAATTATCATGGAGTCAGG + Intergenic
1001405962 5:171477831-171477853 TAGAAGATTAACTTGGAGATTGG - Intergenic
1001566622 5:172703635-172703657 TAGAATTTAAACATGGATTTTGG + Intergenic
1004236789 6:13881488-13881510 CAGAATCAGAACATGGAGATTGG + Intergenic
1004761628 6:18673115-18673137 CAGAGTATAAAAATGGAGTGTGG - Intergenic
1005713731 6:28526753-28526775 CAGAAAATAATCATGAAGTTAGG + Intronic
1007405741 6:41635247-41635269 TAGAATAATAAAATGGTGTTGGG + Intergenic
1009864055 6:69374535-69374557 CAGAATATTATCATAGTGTGTGG - Intronic
1010704483 6:79091170-79091192 GATAAAATTAACATGGATTTGGG + Intergenic
1011189809 6:84717115-84717137 CAGAATCAGAACATGGAGATTGG - Intronic
1011345344 6:86363467-86363489 CAGACTATTTACATTGTGTTAGG - Intergenic
1011539893 6:88418043-88418065 CAGAATCAGAACATGGAGATTGG - Intergenic
1012049095 6:94316881-94316903 CAAAATATTAATATTGACTTAGG + Intergenic
1012324758 6:97903282-97903304 CAGAATATGAATATTGATTTTGG - Intergenic
1012832227 6:104218692-104218714 CATAATATTAACATGGTTATTGG + Intergenic
1013022209 6:106231461-106231483 CAGAATCAGAACATGGAGATTGG + Intronic
1015736557 6:136406474-136406496 AAGAATTTTAACATGGACTGTGG + Intronic
1016343284 6:143084837-143084859 CAGAATCAGAACATGGAGATTGG - Intronic
1016444749 6:144120200-144120222 CAGAATCAGAACATGGAGATTGG - Intergenic
1018248320 6:161843183-161843205 CAGGATAATAATATAGAGTTTGG - Intronic
1018687485 6:166315270-166315292 CAGAATCAGAACATGGAGATTGG + Intergenic
1018761015 6:166894392-166894414 CAGAATCAGAACATGGAGATTGG + Intronic
1020413324 7:7917053-7917075 CATAAATTTAATATGGAGTTTGG - Intronic
1020968021 7:14897575-14897597 CAGGTTATTAACATAGATTTAGG - Intronic
1021045585 7:15918891-15918913 CAGAATTTTAAGATATAGTTAGG - Intergenic
1021882184 7:25105801-25105823 CAGAATTTTAACAAGGAGACAGG + Intergenic
1021905307 7:25327556-25327578 AAGCATATTAACATGTGGTTGGG + Intergenic
1022889520 7:34682164-34682186 CAGAATGTTAACAAGGAATAGGG + Intronic
1023439326 7:40170102-40170124 CAGAATCAGAACATGGAGATTGG - Intronic
1023689457 7:42771300-42771322 GAGAATATTAACATGTAGAGTGG + Intergenic
1023973271 7:45007672-45007694 CATAATAGGAACATGGAATTTGG + Intronic
1024894077 7:54237002-54237024 CAGAATGATAAAATGGACTTTGG + Intergenic
1024894718 7:54244729-54244751 CAGGTTATTAAAATGGAATTAGG + Intergenic
1026525751 7:71151997-71152019 CACAAGATAAAAATGGAGTTCGG + Intronic
1027397667 7:77772860-77772882 CAGAATCTTTACCTGGGGTTTGG - Intronic
1028588616 7:92474510-92474532 CAGAATCAGAACATGGAGATTGG - Intronic
1030843522 7:114382958-114382980 CAGAATCAGAACATGGAGATTGG - Intronic
1030953339 7:115820179-115820201 CAAACTATTAACATTGATTTTGG + Intergenic
1031471494 7:122173788-122173810 CAGAATCAGAACATGGAGATTGG + Intergenic
1032160436 7:129505435-129505457 CAGAATATAGACATGGTGTCAGG + Intronic
1032426121 7:131823486-131823508 CAGAATCAGAACATGGAGATTGG - Intergenic
1032585564 7:133143062-133143084 CAGACTATTAAAATGCAGCTGGG - Intergenic
1032806281 7:135357966-135357988 GAGAAGAATAGCATGGAGTTGGG - Intergenic
1033778763 7:144644687-144644709 CAGAAAATTAACATGGTGGTAGG + Intronic
1034253126 7:149708101-149708123 GAGATGATGAACATGGAGTTGGG + Intergenic
1036445859 8:8821271-8821293 AAGAATCTTAACAAGGAGGTGGG + Intronic
1037570967 8:20157435-20157457 CAGAATCACAACATGGAGATTGG + Intronic
1039077752 8:33707889-33707911 CAGGAAATTAACATGGACATGGG + Intergenic
1039555904 8:38474721-38474743 CAGAATAATAAAATTCAGTTAGG - Intergenic
1040861187 8:52000883-52000905 CAGAATATTCACATAGGTTTGGG - Intergenic
1040989064 8:53329574-53329596 TAGAGTATTAAAATGGAGATTGG + Intergenic
1041663899 8:60424155-60424177 CAGAATCAGAACATGGAGATTGG - Intergenic
1041923474 8:63210327-63210349 CAGAATATTGATATGCAGCTTGG + Intronic
1041956893 8:63566149-63566171 CAGAAAACTAACAGGAAGTTGGG - Intergenic
1042056080 8:64766140-64766162 CAGAATCAGAACATGGAGATTGG + Intronic
1042658581 8:71129088-71129110 CAGAACATTAACCATGAGTTAGG - Intergenic
1045838549 8:106552386-106552408 CAGAATATTCATATAGAGGTGGG - Intronic
1045959060 8:107945725-107945747 CAGAATATAGACCTGGAGTATGG - Intronic
1050161658 9:2726039-2726061 CAGTATATTAAGATGGATTGCGG + Intronic
1050760064 9:9058153-9058175 CAGAATATAAAGAGGGAATTAGG + Intronic
1051360707 9:16279108-16279130 AAGATGATTACCATGGAGTTTGG + Intergenic
1055942526 9:81663987-81664009 GAGAATATTAAAGTGGAGTTTGG - Intronic
1056161665 9:83901915-83901937 CTTTATATTAACATGGAATTGGG + Intronic
1056673821 9:88655933-88655955 CAGAATAATATAATGGACTTTGG + Intergenic
1056725338 9:89109386-89109408 CAGAATACATACATAGAGTTGGG + Intronic
1057003218 9:91531966-91531988 CCCAATATTAGCATGGTGTTTGG + Intergenic
1057320093 9:94004804-94004826 CAGCATATGAATGTGGAGTTGGG + Intergenic
1059369767 9:113818128-113818150 CAGAATTTTAAAATGCAGTAGGG + Intergenic
1059612317 9:115911849-115911871 CAGAATATCAAAATGGAGCTTGG - Intergenic
1060148414 9:121270761-121270783 CAAACTATTCACATGGAGTAGGG - Intronic
1061278647 9:129584370-129584392 CAGAATGTGAGCATGGAGTCTGG + Intergenic
1203620960 Un_KI270749v1:129602-129624 CAGAATATTGACATATAATTAGG - Intergenic
1188012512 X:25072880-25072902 CTGAATATTAAAATAGAATTGGG + Intergenic
1188630805 X:32357582-32357604 CTGAATAATGACATGAAGTTCGG - Intronic
1188794483 X:34444934-34444956 AAGAATAATAAAATGGACTTTGG + Intergenic
1191167119 X:57402781-57402803 CAGAATCAGAACATGGAGATTGG - Intronic
1192309118 X:69995123-69995145 CAGAATATTAGCAGGGATTTTGG - Intronic
1192891059 X:75390705-75390727 CCGAATATTCACAGGGATTTGGG - Intronic
1192940000 X:75902146-75902168 CAGAATCAGAACATGGAGGTTGG - Intergenic
1193088004 X:77464871-77464893 AAGAATAATACCATGGACTTTGG + Intergenic
1193171998 X:78347607-78347629 CAGAATCAGAACATGGAGATTGG - Intergenic
1193306681 X:79959240-79959262 CAGAATCAGAACATGGAGATTGG + Intergenic
1193386183 X:80874097-80874119 CAGAATATTATCATACAGTGTGG + Intergenic
1193767902 X:85554604-85554626 CAGAAGATTAACAAGGAAATAGG - Intergenic
1194284275 X:91990569-91990591 CAGAAAATTTAAATGAAGTTTGG - Intronic
1194563993 X:95459378-95459400 CACAATATTAAAATAAAGTTAGG - Intergenic
1194970764 X:100341081-100341103 CAGAATGTTTAGATGGACTTGGG - Intronic
1195492978 X:105494934-105494956 CAAAGTAGTAACTTGGAGTTTGG + Intronic
1196614739 X:117755192-117755214 CAGAGTAATAAAATGGAGTGGGG + Intergenic
1197370863 X:125624628-125624650 TAGCATTTTAACATGGATTTTGG + Intergenic
1198436114 X:136618359-136618381 CAGAATTTTAAAAAGGGGTTTGG + Intergenic
1200601843 Y:5215128-5215150 CAGAAAATTTAAATGAAGTTTGG - Intronic
1202274499 Y:23101682-23101704 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202291528 Y:23319004-23319026 AAGAAAAATAAAATGGAGTTGGG - Intergenic
1202427492 Y:24735417-24735439 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202443299 Y:24934677-24934699 AAGAAAAATAAAATGGAGTTGGG - Intergenic