ID: 928916556

View in Genome Browser
Species Human (GRCh38)
Location 2:36477987-36478009
Sequence GACTTCAGATTGAAGATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928916556_928916563 23 Left 928916556 2:36477987-36478009 CCCCAGATCTTCAATCTGAAGTC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 928916563 2:36478033-36478055 TCTCTGCACACAAAGTGGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 192
928916556_928916560 18 Left 928916556 2:36477987-36478009 CCCCAGATCTTCAATCTGAAGTC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 928916560 2:36478028-36478050 CCTGATCTCTGCACACAAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 187
928916556_928916562 22 Left 928916556 2:36477987-36478009 CCCCAGATCTTCAATCTGAAGTC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 928916562 2:36478032-36478054 ATCTCTGCACACAAAGTGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 205
928916556_928916561 19 Left 928916556 2:36477987-36478009 CCCCAGATCTTCAATCTGAAGTC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 928916561 2:36478029-36478051 CTGATCTCTGCACACAAAGTGGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928916556 Original CRISPR GACTTCAGATTGAAGATCTG GGG (reversed) Intronic
900765083 1:4499608-4499630 GTCTTCAGAGAGAAGATCTGAGG - Intergenic
901410805 1:9082684-9082706 GAATGCAGATTGATGGTCTGGGG + Intronic
901525382 1:9818672-9818694 GACTACAGATTCAAGATTGGTGG - Intronic
902865017 1:19272301-19272323 AACTTCAGATCTGAGATCTGAGG + Intergenic
904405055 1:30283013-30283035 ATTTTCAAATTGAAGATCTGGGG - Intergenic
906088716 1:43158864-43158886 GACTTCCAATTAAAGATCTTAGG + Intergenic
911512688 1:98827112-98827134 AACTTAAGAGTGATGATCTGTGG + Intergenic
916565785 1:165975670-165975692 GAGTACATATTGAAAATCTGTGG + Intergenic
923944589 1:238869982-238870004 GACTGCAGTTTAAAGAACTGGGG + Intergenic
1064732183 10:18343769-18343791 GACTTCTAATTGGAGACCTGTGG + Intronic
1064761469 10:18625825-18625847 GTCTTTTGATTGGAGATCTGTGG - Intronic
1064762526 10:18635949-18635971 GTCTTCTGCTTGGAGATCTGTGG - Intronic
1065269993 10:24019516-24019538 CATTTCAGATTGAAGATTTGGGG + Intronic
1067234107 10:44434205-44434227 TATTTCAGAAGGAAGATCTGGGG + Intergenic
1069931776 10:71887755-71887777 GTCTTCAGATTGGAGATCATGGG - Intergenic
1071087546 10:81880280-81880302 CACTTCAGTCTGAAGAACTGGGG - Intronic
1072381353 10:94874746-94874768 GATTGCAGATGGAAGAACTGAGG + Intergenic
1073159158 10:101374831-101374853 AACTGAAGATTGAAGATCTCTGG + Intronic
1078083833 11:8221975-8221997 CACTTCATAGTGCAGATCTGGGG + Intergenic
1081343296 11:41953626-41953648 CACTTCAGGTAGAAGAACTGAGG - Intergenic
1083111687 11:60416278-60416300 GTTTTCTGGTTGAAGATCTGGGG - Exonic
1084464638 11:69315002-69315024 AAATTCAGAATGAAGTTCTGAGG - Intronic
1086997801 11:93378704-93378726 TATGTCAGATGGAAGATCTGGGG + Intronic
1087827432 11:102781877-102781899 GACATCAGCTTGAATATCAGAGG + Intergenic
1089254017 11:117184342-117184364 GACTAAAGATGGAAGAACTGAGG + Intronic
1090600096 11:128361395-128361417 TAATTGAGTTTGAAGATCTGAGG + Intergenic
1090955723 11:131511511-131511533 GGCTTCAGATTGAAGTTTGGAGG - Intronic
1091082829 11:132688443-132688465 GATTTCAGATTGGATAACTGAGG - Intronic
1091345262 11:134848068-134848090 TCCTTCAGATTAAAGTTCTGTGG - Intergenic
1092916108 12:13190668-13190690 GACTTTATCTTGAAGTTCTGGGG - Intergenic
1095376393 12:41534233-41534255 AAATTCAGATGGAAGGTCTGTGG - Intronic
1098700642 12:73621056-73621078 GACTTCATAATGAAGATCAAAGG - Intergenic
1098847134 12:75551358-75551380 GACTTCAGATTCAGGCTTTGTGG + Intergenic
1099445412 12:82745902-82745924 GACTTCAGAATTAGGAACTGTGG + Intronic
1099859169 12:88206760-88206782 GACTTAAGATTGAGGATTTAGGG - Intergenic
1103074984 12:117974750-117974772 GACCTCAGAAAGAAGATGTGGGG - Intergenic
1106507243 13:30381851-30381873 GACTTCAGCCTGCAGAACTGTGG - Intergenic
1108156430 13:47590008-47590030 GACTTCATCTTGTAGCTCTGGGG + Intergenic
1110787992 13:79556721-79556743 CAATTCAGATTAAAAATCTGAGG - Intergenic
1112609769 13:100945073-100945095 GACTTCAGAGTCCAGGTCTGTGG + Intergenic
1114738557 14:25069357-25069379 GGCTTCAGAGTTAAGATTTGGGG + Intergenic
1117398424 14:55335172-55335194 GAGATCAGATTGAAGATGTAGGG + Intronic
1117980282 14:61336141-61336163 CACTTCATATTGAAGTGCTGAGG - Intronic
1118140108 14:63071743-63071765 TACGTCAGAAGGAAGATCTGAGG + Intronic
1118828171 14:69403360-69403382 GATTTCAGATTGATTATCTGAGG + Intronic
1123872989 15:24595147-24595169 AACTTCAGAGTGATGAACTGGGG - Intergenic
1124710695 15:32007640-32007662 GCCCTGAGATTGATGATCTGGGG - Intergenic
1126412067 15:48382372-48382394 GAATTCAGGTTGAAGAAATGGGG + Intergenic
1127053297 15:55106955-55106977 AACTTCAGAGTGAAGATTTAGGG + Intergenic
1128354758 15:66918111-66918133 GACTCCAGATTGTTGAACTGGGG + Intergenic
1130882731 15:88069112-88069134 GACTGAAGTTTCAAGATCTGAGG - Intronic
1130977020 15:88784268-88784290 AACTTCTGATTGCAGAGCTGTGG - Intergenic
1131217325 15:90549602-90549624 GCCTTCACTTTGAAAATCTGAGG + Intronic
1131428391 15:92366225-92366247 GTCTTTATAGTGAAGATCTGTGG - Intergenic
1132937065 16:2486553-2486575 GACTCCAGGTTGAAGAGCTGGGG - Intronic
1133169778 16:3975040-3975062 GAGTTCAAATAGCAGATCTGGGG - Intronic
1134352575 16:13451564-13451586 GCCTTCAAACTGAAGATCGGAGG + Intergenic
1136908128 16:34120816-34120838 GTCTACAGATGGAATATCTGGGG + Intergenic
1137329648 16:47479697-47479719 TAATTCAGATTGCAGATCTTGGG + Intronic
1138894179 16:61183045-61183067 GACTTCAGAATGAAGACCCAAGG + Intergenic
1139312998 16:66042878-66042900 GATTTCATTTTGTAGATCTGGGG + Intergenic
1146115520 17:30134417-30134439 TACTACAAATTGAAGATGTGTGG - Intronic
1148392631 17:47283722-47283744 GACTTGAGTCAGAAGATCTGAGG + Intronic
1149404323 17:56331533-56331555 GACTTCAGAATCAAGATCTAGGG + Intronic
1151901922 17:77021799-77021821 AACTTCAGAGTGATGATCTAGGG + Intergenic
1154111673 18:11574473-11574495 GTTTTAACATTGAAGATCTGTGG - Intergenic
1157503523 18:48208447-48208469 GACATGAGTTCGAAGATCTGGGG - Intronic
1166065762 19:40357980-40358002 GACTTCAGATCTCAGCTCTGTGG - Intronic
925652870 2:6110425-6110447 GAAGTCATATTGAAAATCTGGGG + Intergenic
927648813 2:24898563-24898585 GATTTGAGAGTGAAGATCTTCGG - Intronic
928456093 2:31423869-31423891 CACTTAAGGTTGAAGACCTGGGG - Intergenic
928916556 2:36477987-36478009 GACTTCAGATTGAAGATCTGGGG - Intronic
929540731 2:42818428-42818450 GAATTCACAGTGAAGCTCTGTGG + Intergenic
932007557 2:67941941-67941963 GATTCCACATTTAAGATCTGAGG - Intergenic
933110835 2:78397793-78397815 TACATCAGAGGGAAGATCTGGGG - Intergenic
935053770 2:99547068-99547090 GACTTCATACTGATAATCTGTGG + Intronic
935462540 2:103355100-103355122 GTCTTAAGATAGATGATCTGCGG - Intergenic
935633277 2:105230064-105230086 AACTTCAGATTGAAAATATTGGG - Intergenic
940419580 2:153464018-153464040 GACTTCAGGTGGAAAAGCTGTGG + Intergenic
941128321 2:161614304-161614326 GACATCTGAGTAAAGATCTGAGG - Intronic
941291865 2:163685604-163685626 GCCTTCTGATTGATGAGCTGTGG - Intronic
943595854 2:189855077-189855099 CACTACAAATTGAAGAACTGTGG + Exonic
945750860 2:213780636-213780658 GACTTTGGATTTAAGAACTGAGG + Intronic
1169026605 20:2376856-2376878 GACTCCAGAGCCAAGATCTGAGG + Intergenic
1170977563 20:21180868-21180890 GGCCTCAGCTTGAACATCTGAGG - Intronic
1170978411 20:21188431-21188453 GCCTTCAGATTGAAGACCTAAGG - Intronic
1171220066 20:23388163-23388185 GTCTTCAGAATGCAGATCTTAGG + Intronic
1171814876 20:29777342-29777364 GTCTACAGATGGAATATCTGGGG - Intergenic
1171994776 20:31723127-31723149 AAAGTCAGATTGCAGATCTGAGG - Intronic
1175382043 20:58570066-58570088 GACCTCAGCTTGCAGATCAGGGG + Intergenic
1175866610 20:62181536-62181558 CATTTCAGATTGAAGTTTTGGGG - Exonic
1177748034 21:25245088-25245110 GACTCCAGACTTGAGATCTGTGG + Intergenic
1182185204 22:28394403-28394425 GATTTTAGATTTAAGATCAGGGG - Intronic
1182967670 22:34537233-34537255 AACTTAAGAGTGATGATCTGGGG - Intergenic
1185037356 22:48486449-48486471 GAGATCAGATTGAAGAGATGGGG - Intergenic
949392910 3:3582633-3582655 AACTTAAGATAAAAGATCTGGGG - Intergenic
953476718 3:43211595-43211617 GATTTCCGAGTCAAGATCTGGGG + Intergenic
956362036 3:68458935-68458957 GACTTCAGGATCAACATCTGTGG + Intronic
956365079 3:68492422-68492444 GACTTCAGAGAGAATTTCTGAGG + Intronic
957297710 3:78354117-78354139 GCCTTCAGAATGAAGACCTGAGG - Intergenic
960870544 3:122245283-122245305 AACTTCAGATTGAAAATATTTGG - Intronic
961831724 3:129626613-129626635 GACTTCACATTTGAGATCTGAGG + Intergenic
962621098 3:137180174-137180196 GATCCCAGATTGAAGATCTGAGG - Intergenic
963014454 3:140808939-140808961 TATTTCAGAAGGAAGATCTGGGG + Intergenic
964342054 3:155718075-155718097 AACTTCAGAGTGATGATCTAGGG - Intronic
965482753 3:169240571-169240593 GATTTCAGATGGAAGATGTTTGG - Intronic
967754286 3:193151095-193151117 GTCTGCATATTGAAGATCAGTGG - Intergenic
968898112 4:3416907-3416929 TTCATGAGATTGAAGATCTGGGG - Exonic
971271047 4:25146157-25146179 GAATACAGATTGAAAATCTGTGG - Intronic
971541327 4:27820604-27820626 GAGTTCAGATTCAAGGGCTGGGG - Intergenic
971775635 4:30961028-30961050 GACCTCAAAATGAAGATATGTGG + Intronic
972218295 4:36922108-36922130 GACTTCTGATTGCAGGCCTGGGG + Intergenic
974456918 4:62140166-62140188 AACTTCAGATTGCATGTCTGAGG - Intergenic
979523275 4:121692471-121692493 GAGTTCACATTGAAGGTCAGAGG + Intronic
981209776 4:142089237-142089259 GACTTCAGAAAGAAGCTCAGGGG - Intronic
982316184 4:154034345-154034367 GACTTCAGACTGAATTTCTGGGG + Intergenic
983305703 4:165983178-165983200 GAGTTCAGAATGAATATTTGTGG + Intronic
984048293 4:174830221-174830243 GATTTCAGAATAAATATCTGAGG - Intronic
986055346 5:4130853-4130875 AACATCACATTGAAGAGCTGGGG + Intergenic
987755337 5:22093817-22093839 GACTTCAGACTCAAGATTTTGGG + Intronic
988044419 5:25931715-25931737 GTCTTCAGCTTGAAAAACTGGGG - Intergenic
988088895 5:26508782-26508804 GAGTTCAGATTGTAGAGATGGGG + Intergenic
989019950 5:36992664-36992686 GATGTCATATTGAAGATCTCAGG + Intronic
989951443 5:50302965-50302987 CTCTTCTGTTTGAAGATCTGAGG - Intergenic
993620717 5:90164623-90164645 CACTTCAGTTTGAGGATCAGGGG - Intergenic
995823221 5:116262652-116262674 CACTTCAGACTGAAAATCTTGGG - Intronic
996414186 5:123191886-123191908 GACTACAGGTTAAACATCTGTGG - Exonic
997555957 5:134798875-134798897 GACTGCAGATTGAAAATATTTGG + Intronic
998852034 5:146360359-146360381 GGATTCTGAATGAAGATCTGAGG + Intergenic
999112058 5:149130124-149130146 GACTTCTGGATGCAGATCTGGGG - Intergenic
999636719 5:153630598-153630620 GACTTCACTCTGAAGATCTGAGG - Intronic
1000186183 5:158860447-158860469 GACATAAGAATGCAGATCTGGGG + Intronic
1000759067 5:165198615-165198637 GACATCATCTTGAAGATCTCTGG + Intergenic
1001708308 5:173758107-173758129 GGCTGCAGGTGGAAGATCTGGGG + Intergenic
1002609285 5:180403806-180403828 GATGTCAGAGGGAAGATCTGGGG + Intergenic
1004137604 6:12982745-12982767 GACTTGAAATTGAACAACTGGGG + Intronic
1005499684 6:26418921-26418943 AACTTCAGAGTGACGATTTGGGG - Intergenic
1005571546 6:27150176-27150198 AACTTCAGAATGAATATTTGAGG + Intergenic
1006871978 6:37259260-37259282 AACTTCAGATTAAAGTGCTGTGG + Intronic
1007850782 6:44800926-44800948 GACTTCAGAGTGGAGCTCTGTGG + Intergenic
1009278155 6:61712040-61712062 GGCTTCAGATTGAACACATGAGG - Intronic
1014585431 6:123192242-123192264 GGCTTCAGAATCAATATCTGTGG + Intergenic
1014623272 6:123695694-123695716 TTCTTCAGCTTGAAGATCTAAGG - Intergenic
1015406717 6:132845690-132845712 GCCTTCAGACTGCAGATCTTGGG + Intergenic
1015586221 6:134779204-134779226 CAGTTCAGATTCAAGATGTGGGG - Intergenic
1018691372 6:166346649-166346671 GACTTCAAATTCAAATTCTGAGG + Intergenic
1018791075 6:167148209-167148231 CACTTTTGATTGAAGATGTGGGG + Intronic
1023523590 7:41073756-41073778 GACTTCATACTGAAGTTCTAAGG + Intergenic
1024439695 7:49402515-49402537 GACTTCCAATAGAAAATCTGGGG + Intergenic
1024712241 7:52029207-52029229 GACTTCAGAAAGAAAATGTGAGG - Intergenic
1026490826 7:70861864-70861886 GACTTCAGCTTGAAGATTAAGGG - Intergenic
1027837689 7:83266033-83266055 GTTTTCAGTTTGAAGTTCTGAGG - Intergenic
1029002779 7:97172983-97173005 GATTTGAGCTTGATGATCTGAGG - Intronic
1029444194 7:100603720-100603742 GACTGGAGAATGAAGATTTGAGG - Intronic
1030137097 7:106264504-106264526 GATTTCAGATTTCAGAACTGGGG - Intronic
1030169663 7:106588714-106588736 GGCTTCACATTGAAGTTCTCAGG + Intergenic
1032146803 7:129390567-129390589 GACTTCAGATGCAGGATCTCAGG + Intronic
1033805903 7:144953994-144954016 AACTTGAGAGTGATGATCTGGGG - Intergenic
1035049201 7:155988756-155988778 GAATTCAGCCTGAAGTTCTGTGG + Intergenic
1035520381 8:271355-271377 GATTTCAGAGTGAAAATGTGGGG - Intergenic
1037662326 8:20938737-20938759 AGCTTCAGAATGAAGATCTTGGG + Intergenic
1041231025 8:55752245-55752267 AACTTCTCATTAAAGATCTGAGG + Intronic
1043646522 8:82527418-82527440 GTCTTCAGGTTGCAGATTTGTGG - Intergenic
1046037984 8:108867152-108867174 GATTTCAGATTATAGATCTGTGG + Intergenic
1047832628 8:128652853-128652875 GACATCTGATTGGAGATTTGGGG - Intergenic
1050077245 9:1877899-1877921 GAATTAAGATAGAAGGTCTGAGG + Intergenic
1050644607 9:7705534-7705556 GACATCACTTTGAAGATGTGGGG + Intergenic
1053609358 9:39695685-39695707 CACATCTGATTGAAGATTTGAGG - Intergenic
1053867199 9:42451956-42451978 CACATCTGATTGAAGATTTGAGG - Intergenic
1054088957 9:60775803-60775825 CACATCTGATTGAAGATTTGAGG + Intergenic
1054244166 9:62646712-62646734 CACATCTGATTGAAGATTTGAGG + Intergenic
1054558291 9:66681260-66681282 CACATCTGATTGAAGATTTGAGG + Intergenic
1060680797 9:125562291-125562313 CACTTCATATTTAAGAACTGGGG - Intronic
1062087458 9:134656146-134656168 AGCTTCAGATTGAGGGTCTGAGG + Intronic
1185919535 X:4075069-4075091 GTCCTCAGAATGAAGATCAGAGG + Intergenic
1187234054 X:17450105-17450127 GCCTTCAGATTGAAAACTTGAGG + Intronic
1188023053 X:25179340-25179362 GAATTCATATTGAGGATGTGAGG - Intergenic
1188188274 X:27143709-27143731 GACATTTGATTGAAGACCTGAGG - Intergenic
1195669794 X:107460003-107460025 GTCTTCTGATTGCAGATTTGAGG + Intergenic
1196149575 X:112358174-112358196 GACTGCAGATTCAACTTCTGGGG + Intergenic
1196538226 X:116873046-116873068 CTCTTCTCATTGAAGATCTGAGG + Intergenic
1196789746 X:119453209-119453231 GACATCAGTTTGGAGATCTGAGG - Exonic
1196866222 X:120073549-120073571 CACTTCAGCTTGAAGCTTTGTGG + Intronic
1196876875 X:120162732-120162754 CACTTCAGCTTGAAGCTTTGTGG - Intronic
1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG + Intronic
1197719094 X:129732768-129732790 AACTTCAGATTGATGATTTAGGG + Intergenic
1199983640 X:152935124-152935146 AACTTCAGATTGAAAATATTTGG - Intronic
1200456369 Y:3399160-3399182 TACGTCAGAGGGAAGATCTGGGG + Intergenic
1201072131 Y:10156572-10156594 GTCTACAGATGGAATATCTGGGG + Intergenic